ID: 903211779

View in Genome Browser
Species Human (GRCh38)
Location 1:21822897-21822919
Sequence GCCCCACAGCTACCTGAGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903211779_903211789 28 Left 903211779 1:21822897-21822919 CCCGTCTCAGGTAGCTGTGGGGC 0: 1
1: 0
2: 0
3: 9
4: 182
Right 903211789 1:21822948-21822970 CTAGGAGTGAGAACTGCCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 151
903211779_903211781 -4 Left 903211779 1:21822897-21822919 CCCGTCTCAGGTAGCTGTGGGGC 0: 1
1: 0
2: 0
3: 9
4: 182
Right 903211781 1:21822916-21822938 GGGCACCAGCCCACAAGCCGAGG 0: 1
1: 0
2: 0
3: 16
4: 125
903211779_903211786 10 Left 903211779 1:21822897-21822919 CCCGTCTCAGGTAGCTGTGGGGC 0: 1
1: 0
2: 0
3: 9
4: 182
Right 903211786 1:21822930-21822952 AAGCCGAGGTTGGCTCTCCTAGG 0: 1
1: 0
2: 1
3: 4
4: 102
903211779_903211782 0 Left 903211779 1:21822897-21822919 CCCGTCTCAGGTAGCTGTGGGGC 0: 1
1: 0
2: 0
3: 9
4: 182
Right 903211782 1:21822920-21822942 ACCAGCCCACAAGCCGAGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 79
903211779_903211790 29 Left 903211779 1:21822897-21822919 CCCGTCTCAGGTAGCTGTGGGGC 0: 1
1: 0
2: 0
3: 9
4: 182
Right 903211790 1:21822949-21822971 TAGGAGTGAGAACTGCCCAAGGG 0: 1
1: 0
2: 1
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903211779 Original CRISPR GCCCCACAGCTACCTGAGAC GGG (reversed) Exonic
901056351 1:6450273-6450295 GCCCCAGAGCAGCCTGAGCCAGG + Intronic
902477995 1:16698212-16698234 GCCCCAGAGCAGCCTGAGCCAGG - Intergenic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
904329031 1:29745905-29745927 GCCACACAGCTGGCTGTGACAGG - Intergenic
906180779 1:43816917-43816939 GTCTCACAGATACCTGAGAAAGG + Intronic
907402645 1:54233850-54233872 GCCCAACAGCTCACTGAGAACGG + Intronic
907666374 1:56436977-56436999 GTCCCCCAGCTGCCAGAGACTGG + Intergenic
909560852 1:77007883-77007905 GCCCCATAGCTACCTGAGGGAGG + Intronic
911986512 1:104632297-104632319 GCCAATCAGTTACCTGAGACTGG - Intergenic
912927993 1:113929983-113930005 TCCCCTCAGCTCCCTGAGGCGGG + Intronic
913305733 1:117429296-117429318 GCCCAACAGCTCACTGAGAACGG - Intronic
916028496 1:160855961-160855983 GCCCCACACCTTCCTCCGACTGG - Intronic
916624107 1:166534979-166535001 CCCCAACAGCAATCTGAGACAGG + Intergenic
919358033 1:196551355-196551377 TCCCCACATCTACCTGCCACTGG - Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
920307975 1:205031135-205031157 GCCCCATAGAGACCTGTGACAGG + Intergenic
922416166 1:225425422-225425444 TCCCTACACCTACCTGAGATTGG + Intronic
922644967 1:227276577-227276599 GCCCAACAGCTCCTTGAGAGCGG + Intronic
922718641 1:227889307-227889329 CCCCCAGAGCTACCTGGGAAGGG - Intergenic
922744875 1:228038130-228038152 GCCCCGGAGCCACCTGAGAGCGG - Intronic
922757504 1:228104751-228104773 GCCCCACACCATCCTGAGATGGG - Intronic
1063864142 10:10345590-10345612 CCTCCACATCTACCTGTGACGGG - Intergenic
1064306091 10:14167862-14167884 GCCCTATAGCTCCCTGAGCCTGG - Intronic
1065879793 10:30028642-30028664 GCCCCACAGCCACCGGGGGCTGG + Exonic
1067702822 10:48585966-48585988 GCCCAACAGCGCCCTGAAACTGG + Intronic
1070244771 10:74720580-74720602 GCTCTACAGCAACCTGAGCCAGG - Intergenic
1070796900 10:79222152-79222174 GGCCCACAGACACCTGAGATTGG + Intronic
1071616746 10:87081447-87081469 GCCCAACAGCTCACTGAGAACGG + Intronic
1076505312 10:130968796-130968818 GCCCCAGAGATCCCTGAGAAGGG - Intergenic
1076909893 10:133381717-133381739 GCCCCAGAGCCAACTGAGGCAGG - Intronic
1077116861 11:889117-889139 ACCCCACAGCTGCCAGAGGCCGG + Intronic
1077196562 11:1283899-1283921 GCCCTCCAGCTTCCTGAGGCTGG - Intronic
1080641242 11:34159736-34159758 GCCCCACAGCGGGATGAGACGGG - Intronic
1081243897 11:40739853-40739875 CTCACACTGCTACCTGAGACTGG - Intronic
1083855972 11:65393276-65393298 GCCCCACGGCAAGCTGAAACTGG - Intronic
1084329920 11:68424254-68424276 GCCCCCCAGCTATCTGAGGAAGG - Intronic
1084402933 11:68955751-68955773 GCCCCAGAGTGGCCTGAGACCGG - Intergenic
1085477227 11:76796231-76796253 GCCCCTGCGCTACCTGAGCCTGG + Exonic
1085493522 11:76945875-76945897 GTCCCACAGCTGCCTGAAACAGG + Intronic
1085793997 11:79520200-79520222 ACCCCACCCCTACCTAAGACAGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1095970968 12:47901822-47901844 GCCCCACCCCAACCTCAGACAGG - Intronic
1098505078 12:71239795-71239817 CCACCACAGCTATCTGAGATGGG + Intronic
1112613901 13:100983583-100983605 GCCCCACAGCCATCTCATACTGG - Intergenic
1113519482 13:110929448-110929470 GCCCCTCAGCTGCCTGACCCTGG + Intergenic
1114318004 14:21525039-21525061 CCCTCAGAGCTACCTGGGACAGG - Exonic
1115645598 14:35366746-35366768 GTCACACAGCTATCTGAGAGGGG - Intergenic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1118148852 14:63166223-63166245 GCCCCTCACCTCCCGGAGACGGG - Intergenic
1119470306 14:74893371-74893393 GCCCCACCACTAGCTGAGCCAGG + Exonic
1119703944 14:76772647-76772669 TCCCCGCAGCTGCCTGAGCCTGG - Intronic
1122249235 14:100426629-100426651 GCCCCACAGCTATCCTAGAATGG + Intronic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124221891 15:27856452-27856474 CCCCCACAGCTTCCTGCCACAGG - Intronic
1125578176 15:40768924-40768946 GCCCCACAGCTCTCTGCTACGGG - Intronic
1125914668 15:43474894-43474916 CCCCAACAGCAACCTGAGGCTGG + Intronic
1127257959 15:57307247-57307269 GGCCCCCAGCTAGCTGAGAATGG - Intergenic
1127283182 15:57509521-57509543 GCTCCTCAGCTTCCTGAGTCAGG + Intronic
1127921301 15:63496403-63496425 GTCCCACAGGTAACTGAGAAAGG + Intergenic
1129325069 15:74795561-74795583 GCCCCTCTGCTTCCTGAGACAGG + Intronic
1130834902 15:87640584-87640606 CCTCCACATCTACCTGAAACTGG + Intergenic
1132975348 16:2708421-2708443 TCCCCACAGCCAGCTGAGAAAGG - Exonic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1133412620 16:5580793-5580815 GCCCTACAGCTTCCTGGGTCTGG - Intergenic
1136027940 16:27481941-27481963 TCCCCACAGCAAATTGAGACTGG - Intronic
1138252587 16:55514074-55514096 ACATCACAGCTGCCTGAGACAGG + Intronic
1141447125 16:84068198-84068220 GCCCCACAGCTGGGTGAGCCTGG - Intronic
1141729619 16:85812928-85812950 GCTACTCAGCTACCTGAGGCAGG - Intergenic
1143491251 17:7286416-7286438 GCCCCATAGCCTCCTGGGACAGG - Exonic
1146567471 17:33925576-33925598 GCCCCACTCCTACCTTAGAAAGG + Intronic
1147030078 17:37626501-37626523 TCTAAACAGCTACCTGAGACTGG - Intronic
1147617027 17:41835846-41835868 GCCCCAGAGGTACCTGTAACCGG + Exonic
1147754208 17:42757505-42757527 GCTCCACAGCAGGCTGAGACAGG - Intergenic
1147785215 17:42973494-42973516 GCCCAACAGCTCACTGAGAACGG + Intronic
1153646688 18:7202291-7202313 TGGCCACAGCTACCAGAGACTGG + Intergenic
1161459151 19:4386216-4386238 GCCCCACAGCTGACTCAGGCAGG - Intronic
1161678151 19:5664760-5664782 GCCGCACAGCTGACTCAGACAGG + Intronic
1162133625 19:8542452-8542474 CCCCCAGAGATCCCTGAGACAGG - Intronic
1162428559 19:10612643-10612665 CCCCCACAGCTTCCGGACACTGG - Intronic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1164894427 19:31859666-31859688 GACTAACAGCTACCAGAGACTGG - Intergenic
1165384660 19:35503214-35503236 GCCCCACAGCTTCGGGAAACGGG - Intronic
1166371985 19:42307022-42307044 GCCCCACAGCTACGTGAAGTGGG + Intronic
1167450783 19:49567520-49567542 GCCCCAGGGCTTCCTGGGACTGG + Intronic
1168289754 19:55351860-55351882 GCCCCACTGATGCCTGAGCCAGG - Intronic
1168625715 19:57916366-57916388 GCGCCACAATTACCTGAGTCGGG + Exonic
1202712015 1_KI270714v1_random:24039-24061 GCCCCAGAGCAGCCTGAGCCAGG - Intergenic
926721632 2:15965603-15965625 GCCCCAGAGTTCCCTGAGAAGGG - Intergenic
931756024 2:65375314-65375336 TGGTCACAGCTACCTGAGACCGG - Intronic
931768715 2:65479317-65479339 TCCCCACATGTACCTGAGCCTGG - Intergenic
932064191 2:68536004-68536026 GCTCCACTGCTACCTGAAAAAGG + Intronic
932339827 2:70956291-70956313 GCCCCACAGCCACCATAGCCGGG + Intronic
932573517 2:72950634-72950656 GCCCCACACTTACCTCAGAGAGG - Intronic
932576376 2:72964503-72964525 GCTCCACAGCCACATCAGACTGG + Intronic
932607110 2:73172730-73172752 GTCCCTCAGCTTCCTGAGACAGG + Intergenic
934618888 2:95792150-95792172 TCCCCACAGAAACCTGAGCCGGG - Intergenic
934642005 2:96032407-96032429 TCCCCACAGAAACCTGAGCCGGG + Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
934979444 2:98827837-98827859 TCCCCTCAGCTTCCAGAGACAGG - Intronic
937437760 2:121893273-121893295 GCCCAACAGCTCACTGAGAACGG + Intergenic
943297035 2:186153824-186153846 GCCCAACAGCTCACTGAGAACGG - Intergenic
944516342 2:200515443-200515465 GAGACACAGCTACTTGAGACTGG - Intronic
946027368 2:216679859-216679881 GGCCGACAGCTGGCTGAGACCGG + Intronic
946649396 2:221874723-221874745 GTCCCACAGCTACATGAGCATGG + Intergenic
947284436 2:228496727-228496749 TCCCAACAGTTACCTGAGAAGGG + Intergenic
948192657 2:236071856-236071878 GCACCACAGCTGCCTGCGGCTGG + Intronic
1172633819 20:36395945-36395967 GTCCCAGAGGTCCCTGAGACTGG + Intronic
1174491990 20:50906345-50906367 TGCCCACAGATACCTAAGACTGG + Intronic
1175515064 20:59564263-59564285 GCTCTCCAGCTTCCTGAGACCGG - Intergenic
1176423818 21:6535535-6535557 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1177640071 21:23834393-23834415 GCCCCAGAGCCCTCTGAGACAGG - Intergenic
1179699311 21:43143850-43143872 GCACCACAGCTGCCAGAGGCAGG - Intergenic
1180303234 22:11054006-11054028 GCCCGACAGCCTCCTGAGGCTGG - Intergenic
1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG + Intergenic
1181435948 22:22910961-22910983 GGCCAGCAGCTACCTAAGACTGG + Intergenic
1182499111 22:30732698-30732720 CCCCCACAGCTACAGCAGACAGG - Intronic
1183472509 22:38017059-38017081 GCCCCACAGCTGCCTCAGGAGGG - Intronic
1183743439 22:39680414-39680436 GCCCTGCAGCCACCTGAGGCTGG - Intronic
1184515623 22:44960272-44960294 CCTCCACAGCTACCTGAGTTCGG + Intronic
1184931003 22:47681385-47681407 GTCCCACAGCCACCTGCGAGAGG - Intergenic
1184973231 22:48042844-48042866 GCCCCACCCCGACCTGAGCCTGG - Intergenic
1185153853 22:49181725-49181747 GCCACACAGCTCCCTGAGGGTGG + Intergenic
950098225 3:10342428-10342450 GCCCCAGAGGCACCTGAGGCTGG - Intronic
952764831 3:36944895-36944917 GCCCGAAAGCTACCGGAGCCCGG + Exonic
952823610 3:37506465-37506487 GCCTCAAAGATATCTGAGACTGG - Intronic
954422537 3:50426239-50426261 GCCCCACAGCAAGTAGAGACTGG + Intronic
957590686 3:82193860-82193882 TCTACAGAGCTACCTGAGACTGG + Intergenic
960698793 3:120420788-120420810 GGCTCACAGCTACATGTGACTGG + Intronic
962843415 3:139255136-139255158 GTCCCATAGCAAGCTGAGACAGG - Intronic
962947134 3:140182478-140182500 GCCCCACAGCTCTCTGAGCTCGG + Intronic
964771136 3:160225499-160225521 GCGCCTCAGCTACCTGCGGCCGG - Intergenic
968052420 3:195664259-195664281 GCCCCCCGTCCACCTGAGACAGG + Intergenic
968103390 3:195984081-195984103 GCCCCCCGTCCACCTGAGACAGG - Intergenic
969095702 4:4731051-4731073 GGCCCAAAATTACCTGAGACAGG + Intergenic
969335286 4:6504788-6504810 GGCCCACAGGTTCCTGAGGCTGG - Intronic
971646777 4:29216915-29216937 GCCTCCCAGATAGCTGAGACGGG - Intergenic
973757207 4:54087078-54087100 ACCCCACATCTTCCTGAGAGAGG - Intronic
974588812 4:63918439-63918461 GCCCAACAGCTCACTGAGAACGG - Intergenic
982309883 4:153973830-153973852 CTCACACTGCTACCTGAGACTGG - Intergenic
982754446 4:159202077-159202099 ACGACACAGCTATCTGAGACAGG - Intronic
985639726 5:1058022-1058044 GCCCCAAGCCTCCCTGAGACGGG - Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985784867 5:1888128-1888150 GCCCCCCAGCTCCCTGAGGGAGG - Intergenic
992290166 5:75271657-75271679 GCCCAACAGCTCACTGAGAACGG + Intergenic
992314304 5:75536719-75536741 GCCCCCCAGCTACCAGAGGCAGG + Intronic
994174946 5:96701315-96701337 GCCCCACAGCTTCCAGAGTTAGG - Intronic
998046512 5:138991233-138991255 GTCCCACAGCTACTTCAGCCAGG - Intronic
998134478 5:139667536-139667558 GCCCCACACCCACCTGAACCAGG - Intronic
1000635928 5:163643742-163643764 GCCCCACAGGCACCTGAATCTGG - Intergenic
1001299106 5:170520964-170520986 GCCCCACAGCAACCCAAGAAGGG - Intronic
1002928675 6:1619423-1619445 GCCCCACAGGCACCAGGGACTGG - Intergenic
1004046092 6:12025041-12025063 TTCCTACAGCTACCTGAGACAGG + Intronic
1004691104 6:17992792-17992814 GCCCCTCAGATACTTGAGGCTGG + Intergenic
1006837318 6:37006863-37006885 GCTCCAGAGCTCCCTGGGACAGG - Intronic
1007341633 6:41194412-41194434 GCCCCACAGGTACCTGATGGAGG + Exonic
1007656338 6:43453254-43453276 GTCCTACACCTACCTGGGACAGG - Intronic
1013204881 6:107935291-107935313 GCCCAACAGCTCACTGAGAACGG + Intronic
1017817933 6:158028474-158028496 GCCGCCCAGCTGCCTGAGGCTGG - Intronic
1017847562 6:158272584-158272606 CCTCCACAGCTGCCTGAGATAGG + Intronic
1019568092 7:1694589-1694611 ACCCCCCACCTCCCTGAGACAGG + Intronic
1019659207 7:2214561-2214583 GCCCCACAACCACCGGAGAAAGG + Intronic
1019927638 7:4203901-4203923 GCGGCTCAGCTGCCTGAGACAGG + Intronic
1020144281 7:5630802-5630824 TCACCACAGCTCCCTGAGTCAGG + Intronic
1022393198 7:29961563-29961585 GCCCAACAGCTCACTGAGAACGG - Intronic
1030670415 7:112329635-112329657 GTCCCACAGCTAGCTGGCACTGG + Intronic
1032164660 7:129536053-129536075 GCCCCACAGCCCCTTGTGACAGG - Intergenic
1032347701 7:131132522-131132544 GCCCTCCAGCTAACTGAGAATGG - Intronic
1036067202 8:5395304-5395326 GCCCCTCAGGCAGCTGAGACAGG - Intergenic
1037187649 8:16082997-16083019 CCCCCACATCTACCTGATAATGG - Intergenic
1045039936 8:98213819-98213841 GCTCCACAGCAACCTGAAGCTGG - Intronic
1045319150 8:101068512-101068534 GCCCACCAGATACCTGAGCCTGG - Intergenic
1045703715 8:104896484-104896506 CCCCCAAAACTCCCTGAGACTGG + Intronic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1053060964 9:35031258-35031280 GACCCACAGACACCTGAGAAGGG + Intergenic
1053501375 9:38597491-38597513 GCCCCATATCTACTTGATACTGG + Intergenic
1055518817 9:77060647-77060669 GCCCCACAGCTCATTGAGAACGG - Intergenic
1057572834 9:96217507-96217529 GCCCCCCAGCTCGCTGAGAGGGG + Intergenic
1058705526 9:107634970-107634992 GCTCCACAGTTTCCTCAGACGGG + Intergenic
1058960630 9:109989696-109989718 TCCACACAGCCAGCTGAGACTGG - Intronic
1060900214 9:127250476-127250498 GCCCCTCTGCTAACAGAGACAGG + Intronic
1062103685 9:134741184-134741206 GCCGCACAGGCACCTGAGCCCGG - Intronic
1062398843 9:136363631-136363653 GCCCCACAGCCGCCTCAGGCAGG + Exonic
1062466348 9:136683296-136683318 GCCTCCCAGCTGCCTGAGCCAGG - Intronic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1186466025 X:9785650-9785672 GCCCCCCAGCAGCCTGAGCCGGG - Intronic
1188904085 X:35771830-35771852 GAACCCCAGATACCTGAGACAGG + Intergenic
1190532835 X:51396609-51396631 GCCACACAGCTGTCTGACACCGG + Intergenic
1192373786 X:70538456-70538478 GCCTCACGTCTCCCTGAGACTGG - Intronic
1194395024 X:93372857-93372879 CCCCCACAGCGTTCTGAGACAGG + Intergenic
1198629449 X:138618467-138618489 GGCTCACAGCAACCAGAGACTGG + Intergenic
1198760799 X:140030321-140030343 TCCCAACAACTACATGAGACTGG + Intergenic
1200059912 X:153479620-153479642 GCCCCAGTGCCTCCTGAGACAGG + Intronic