ID: 903212031

View in Genome Browser
Species Human (GRCh38)
Location 1:21823936-21823958
Sequence GACTGAACTCCGCTGGGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903212031_903212039 4 Left 903212031 1:21823936-21823958 CCTGCCCCCAGCGGAGTTCAGTC 0: 1
1: 0
2: 2
3: 7
4: 124
Right 903212039 1:21823963-21823985 ATGGAAGCCCGAGCCCTGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
903212031_903212046 24 Left 903212031 1:21823936-21823958 CCTGCCCCCAGCGGAGTTCAGTC 0: 1
1: 0
2: 2
3: 7
4: 124
Right 903212046 1:21823983-21824005 TGGTGGGTTCTCCCCTCCCCTGG 0: 1
1: 0
2: 3
3: 23
4: 245
903212031_903212041 8 Left 903212031 1:21823936-21823958 CCTGCCCCCAGCGGAGTTCAGTC 0: 1
1: 0
2: 2
3: 7
4: 124
Right 903212041 1:21823967-21823989 AAGCCCGAGCCCTGGCTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 169
903212031_903212040 7 Left 903212031 1:21823936-21823958 CCTGCCCCCAGCGGAGTTCAGTC 0: 1
1: 0
2: 2
3: 7
4: 124
Right 903212040 1:21823966-21823988 GAAGCCCGAGCCCTGGCTGGTGG 0: 1
1: 0
2: 5
3: 31
4: 274
903212031_903212038 0 Left 903212031 1:21823936-21823958 CCTGCCCCCAGCGGAGTTCAGTC 0: 1
1: 0
2: 2
3: 7
4: 124
Right 903212038 1:21823959-21823981 CGAGATGGAAGCCCGAGCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903212031 Original CRISPR GACTGAACTCCGCTGGGGGC AGG (reversed) Exonic
900998346 1:6134799-6134821 CACTGAACTCCAAGGGGGGCGGG - Exonic
901660882 1:10796939-10796961 AACTCAACTCAGCTGGGGGGGGG - Intergenic
903212031 1:21823936-21823958 GACTGAACTCCGCTGGGGGCAGG - Exonic
903281483 1:22252501-22252523 GGCTGGACTGGGCTGGGGGCTGG + Intergenic
910986395 1:93008754-93008776 GACTACACACCGGTGGGGGCAGG + Intergenic
912776261 1:112508238-112508260 GACTGAGCTCCGCTGAGCCCAGG + Intronic
913530729 1:119732562-119732584 AGCTGAACTCAGCTGGGGGTTGG - Intronic
917920479 1:179745434-179745456 GACTGGACTGTGCTGGGGCCAGG - Intronic
923737994 1:236630114-236630136 GACTGAATTCAGCAGGTGGCTGG - Intergenic
924906041 1:248453480-248453502 GGATGAACTCTGCTGAGGGCCGG + Exonic
924921849 1:248638557-248638579 GGATGAACTCTGCTGAGGGCCGG - Exonic
1067362481 10:45594970-45594992 GACTGCAGCGCGCTGGGGGCGGG + Intergenic
1069749322 10:70735458-70735480 GAGTGAACACCTGTGGGGGCAGG + Intronic
1069827596 10:71263555-71263577 GATTGTTCTCGGCTGGGGGCTGG - Intronic
1070775946 10:79109879-79109901 GACTGAGGTCTGCTGGGGGAAGG - Intronic
1070986701 10:80695797-80695819 GACTGAAATGAGATGGGGGCAGG - Intergenic
1071526749 10:86363743-86363765 GACTGCTCTGCGCTGCGGGCCGG - Intronic
1072806033 10:98424526-98424548 CACTGAAGTCTGCAGGGGGCTGG - Intronic
1074444012 10:113503449-113503471 TACTGAACTGCACTTGGGGCAGG + Intergenic
1075160888 10:120023634-120023656 GACTGGACCCCACTGGTGGCTGG + Intergenic
1075336928 10:121615498-121615520 CACTGAACTCTGCTTGCGGCTGG - Intergenic
1076048825 10:127315985-127316007 CACTGCACCCCGCTGGGGACAGG + Intronic
1076830761 10:132993022-132993044 GCCTGGAGTCCGCCGGGGGCGGG - Intergenic
1076905875 10:133360745-133360767 GTCTGCACTGAGCTGGGGGCAGG + Intergenic
1076944548 10:133637395-133637417 CGCTGGGCTCCGCTGGGGGCCGG + Intergenic
1077531825 11:3100837-3100859 GACTGCACTGCTCTGGGGCCTGG - Intronic
1079508284 11:21180052-21180074 GACTGAATTTAGTTGGGGGCAGG + Intronic
1083439683 11:62667676-62667698 CGCTGGACTCAGCTGGGGGCAGG - Exonic
1083617202 11:64032167-64032189 GCCTGTTCTCAGCTGGGGGCAGG - Intronic
1086337011 11:85810635-85810657 GACTGACCTGGGCTTGGGGCTGG - Intronic
1087008378 11:93490804-93490826 GACTGAACTGCCTTTGGGGCAGG + Intronic
1096462356 12:51829043-51829065 GACCAAACTGGGCTGGGGGCAGG + Intergenic
1096518617 12:52171774-52171796 GCTTAAACTCCCCTGGGGGCTGG + Intronic
1099793314 12:87363691-87363713 TACTGAACTCCTCTGGGGAGGGG - Intergenic
1103260556 12:119584920-119584942 GACTGAATCCTGCTGGGTGCAGG - Intergenic
1106704702 13:32268005-32268027 TACTGCACTCCTCTGGAGGCAGG - Intronic
1114624130 14:24117521-24117543 CACAGAACTCCGATGGAGGCTGG - Intronic
1119959589 14:78839568-78839590 GACTGCACACCCCTTGGGGCTGG + Intronic
1122227370 14:100287494-100287516 GTCTGAACTCCGCAGGGATCTGG - Intergenic
1202926679 14_KI270724v1_random:31856-31878 TACTGGGCTCCGCTGGGGGCTGG - Intergenic
1124221596 15:27854286-27854308 GTCTGGACTCCGCTGGGGCTGGG - Intronic
1125511755 15:40296003-40296025 GGCTGAACTGTGCTGTGGGCTGG - Intronic
1127263568 15:57343752-57343774 GACTGAAGACCCCTGTGGGCAGG + Intergenic
1128183553 15:65625322-65625344 GACTGAGCTCCTCTGGGAGCAGG - Exonic
1128816418 15:70612456-70612478 GATTGCAGTCAGCTGGGGGCTGG - Intergenic
1132149107 15:99447270-99447292 GGCTGAGCTGGGCTGGGGGCAGG - Intergenic
1132615712 16:840316-840338 GACTCATCTTCCCTGGGGGCAGG - Intergenic
1133440313 16:5815843-5815865 TAATGAACTCAGATGGGGGCAGG + Intergenic
1133452680 16:5916912-5916934 GACTGAATTCAGCTGTGCGCAGG + Intergenic
1134765207 16:16751469-16751491 GACTGCACTCAGCTGAGTGCAGG - Intergenic
1134980846 16:18607742-18607764 GACTGCACTCAGCTGAGTGCAGG + Intergenic
1141282947 16:82645242-82645264 GAATGAAAGCCTCTGGGGGCAGG + Intronic
1141484011 16:84326749-84326771 GAGTGACCTCAGCTGGGGGAGGG + Intronic
1143141117 17:4742327-4742349 GACAGCACTACACTGGGGGCTGG - Exonic
1143837961 17:9707876-9707898 GACTGAAGTCCCATGAGGGCAGG - Intronic
1146300620 17:31686252-31686274 GACTGAGCACCGCTGGGGGCAGG + Intergenic
1146458098 17:33022754-33022776 GACTGAAAGCCCCTGAGGGCAGG - Intronic
1148104500 17:45112215-45112237 GACTGCGCTCCTCTGGGGGAAGG + Exonic
1148216349 17:45835838-45835860 GCCTGGACTCCACAGGGGGCTGG + Intergenic
1151343448 17:73486692-73486714 GACTGCACTCCACTGGGTACAGG - Intronic
1151674003 17:75588778-75588800 GACTCGAGTCCGCTGGGGACCGG + Intergenic
1151784864 17:76270506-76270528 GACTGGACGCCGCCGGGCGCTGG + Exonic
1154194098 18:12253649-12253671 GAGTGAACCCCGCTGGGGCTGGG - Intergenic
1156208725 18:34914579-34914601 GAGTGAACTCCGCTGGGGTGCGG - Intergenic
1156687433 18:39666785-39666807 GAAAGAACTGGGCTGGGGGCAGG + Intergenic
1156836182 18:41558047-41558069 CACTGACCTCTGCTGGGGGCAGG + Intergenic
1160762313 19:791803-791825 AGCTGAACTCCCCTGGGGGTAGG + Intergenic
1160846236 19:1167437-1167459 GCCTGAGCTCGGCCGGGGGCGGG + Intronic
1163100424 19:15092529-15092551 GACTGAACTCTGCTGCTGTCTGG + Intergenic
1165761772 19:38325883-38325905 GACTGAACTCAGGTGTTGGCAGG + Intronic
1166807276 19:45494806-45494828 GACTGAGCGGCCCTGGGGGCGGG + Exonic
1168133607 19:54336657-54336679 TCCTGAACTCTCCTGGGGGCAGG + Intronic
925781586 2:7386912-7386934 CACTGAAATCCACTGGGGCCAGG - Intergenic
927919641 2:26961997-26962019 GCCTGAGCTGCTCTGGGGGCAGG - Intergenic
933812252 2:86040112-86040134 GACTGCACACTGCTGGGGGAAGG - Intronic
942414853 2:175747840-175747862 GGATTAACTCAGCTGGGGGCGGG - Intergenic
944204905 2:197147969-197147991 GACTGAAGTCTGCTGGGTGAAGG - Intronic
948697458 2:239739383-239739405 GTCTGGCCTCCGCTGTGGGCTGG + Intergenic
949010560 2:241676037-241676059 GTCTGGACTCTGCTGGGGACGGG + Exonic
1169908268 20:10625022-10625044 GACTGGGTTCCGCTGGGAGCAGG - Exonic
1171781902 20:29427387-29427409 TGCTGGGCTCCGCTGGGGGCCGG + Intergenic
1173247178 20:41344865-41344887 GCCTGGACACCGCTGGGGTCAGG + Intronic
1177103776 21:16929082-16929104 GCTTGAACTCGGGTGGGGGCAGG + Intergenic
1177198679 21:17930034-17930056 GACTGCAGGCCTCTGGGGGCTGG - Intronic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1181531808 22:23521512-23521534 GCCTGACCTCCCCTGGGGGTGGG - Intergenic
1182762410 22:32733558-32733580 GACTGAGCTCCGCCAGGCGCCGG - Intronic
1184038244 22:41928652-41928674 GCCTGAGCTGCTCTGGGGGCAGG + Intergenic
953496746 3:43393987-43394009 GAATGAACACCCCTGGGGGTGGG + Intronic
954925755 3:54232877-54232899 GATTGATCTCCACTGGGTGCTGG + Intronic
957083600 3:75659010-75659032 TGCTGGGCTCCGCTGGGGGCCGG - Intergenic
961731804 3:128970876-128970898 GACTGAGCCCCTCTGGGTGCAGG - Exonic
963082056 3:141402973-141402995 GACTGCAAACCCCTGGGGGCAGG - Intronic
968905705 4:3449688-3449710 GGCTGGACTCTGCTGGGGCCTGG - Intergenic
975264230 4:72343032-72343054 CAGTGTACTCTGCTGGGGGCTGG - Intronic
978761082 4:112357007-112357029 CGCTGAACTCCGGTTGGGGCTGG - Intronic
985447934 4:190037905-190037927 CGCTGGGCTCCGCTGGGGGCCGG + Intergenic
996389751 5:122947045-122947067 GAGTGAACATGGCTGGGGGCAGG + Intronic
997337471 5:133118380-133118402 GCCTGACCTGCCCTGGGGGCCGG + Intergenic
998108103 5:139481370-139481392 GGCTGAGCTGGGCTGGGGGCTGG - Intronic
1001544014 5:172558800-172558822 GAATGAACTGGGCTGGGGGTGGG + Intergenic
1001583986 5:172820433-172820455 CACTGAACCCCGCTGGGGAATGG + Intergenic
1005951460 6:30634537-30634559 GACTGAACCTGGCTGGGCGCCGG - Intronic
1007230344 6:40343763-40343785 GGGTGAACTGCTCTGGGGGCTGG + Intergenic
1010777648 6:79905667-79905689 CACTGGACTCTGCTGTGGGCAGG + Intergenic
1019603646 7:1897828-1897850 GACTGAAGTCCGTGTGGGGCCGG - Intronic
1020033900 7:4952172-4952194 GACTGCAAGCCGCTGGGAGCAGG - Intronic
1020278737 7:6639174-6639196 GACTGACCACTGCTGGGGGTAGG - Intronic
1023394073 7:39736019-39736041 CACTGATCTCAGCTGGTGGCAGG + Intergenic
1030071175 7:105698785-105698807 GACTGAAGTTCCCTGAGGGCAGG + Intronic
1031309344 7:120175400-120175422 GACTGCACTTCACTGTGGGCTGG - Intergenic
1032080179 7:128854764-128854786 TGCTGAACTCGGCTGGGGACAGG - Exonic
1034574888 7:151988168-151988190 CACTGCCCTCCCCTGGGGGCAGG + Intronic
1035726739 8:1829406-1829428 GCTTGAAGTCCGCTGAGGGCTGG + Intronic
1038524555 8:28261825-28261847 GAGTGAACTCTGCTGCGGCCAGG - Intergenic
1043519701 8:81031349-81031371 GACAGAGCTTCGCTGGGTGCAGG + Intronic
1044184489 8:89235722-89235744 GGCTGAAGTCCGCAGGGTGCCGG + Intergenic
1049328182 8:142034907-142034929 GACTGCACTGTGCTGGGGGTCGG - Intergenic
1049536091 8:143183192-143183214 GACTGAGCTCAGCTGCGTGCAGG - Intergenic
1049578360 8:143399947-143399969 GCCTGCAGTCTGCTGGGGGCTGG + Intergenic
1049606424 8:143531381-143531403 GTCAGACCTCGGCTGGGGGCGGG - Intronic
1051179865 9:14399603-14399625 AACTTAACTCTTCTGGGGGCAGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059856460 9:118403529-118403551 GGCTGGTCTCCGCTGAGGGCTGG - Intergenic
1060234625 9:121853613-121853635 GACTGCAGGCAGCTGGGGGCCGG + Intronic
1060333167 9:122694390-122694412 GACTGACCTCAGATGGGGGCAGG - Intergenic
1060736022 9:126067030-126067052 GACTGAGCTCTGCTGGGGGCTGG + Intergenic
1203441691 Un_GL000219v1:15611-15633 CGCTGGACTCCGCTGGGGGCCGG + Intergenic
1203512501 Un_KI270741v1:134520-134542 CGCTGGACTCCGCTGGGGGCCGG + Intergenic
1187017138 X:15341070-15341092 GACTGAAATTAGCTGGGGGAGGG - Intergenic
1190335521 X:49259468-49259490 GGGTGAACTCTGATGGGGGCTGG - Intronic
1192277503 X:69648592-69648614 GACTGAACTCCTGTGGGGAGGGG - Intronic
1193270977 X:79530318-79530340 GTCTGAAGTCCGCTGGAGACAGG - Intergenic
1196925557 X:120630205-120630227 CTCTGAACTCGGCAGGGGGCGGG - Intergenic