ID: 903216662

View in Genome Browser
Species Human (GRCh38)
Location 1:21847285-21847307
Sequence CCTGGGGAGAAGGAACTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903216662_903216675 26 Left 903216662 1:21847285-21847307 CCTGAAAGTTCCTTCTCCCCAGG 0: 1
1: 1
2: 3
3: 29
4: 256
Right 903216675 1:21847334-21847356 CCTTTCCTAGGCAGACTCACCGG 0: 1
1: 0
2: 3
3: 16
4: 153
903216662_903216676 29 Left 903216662 1:21847285-21847307 CCTGAAAGTTCCTTCTCCCCAGG 0: 1
1: 1
2: 3
3: 29
4: 256
Right 903216676 1:21847337-21847359 TTCCTAGGCAGACTCACCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903216662_903216677 30 Left 903216662 1:21847285-21847307 CCTGAAAGTTCCTTCTCCCCAGG 0: 1
1: 1
2: 3
3: 29
4: 256
Right 903216677 1:21847338-21847360 TCCTAGGCAGACTCACCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 69
903216662_903216670 14 Left 903216662 1:21847285-21847307 CCTGAAAGTTCCTTCTCCCCAGG 0: 1
1: 1
2: 3
3: 29
4: 256
Right 903216670 1:21847322-21847344 GCATCCCTCGTCCCTTTCCTAGG 0: 1
1: 0
2: 1
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903216662 Original CRISPR CCTGGGGAGAAGGAACTTTC AGG (reversed) Intronic
900335680 1:2161854-2161876 CCTTAGTTGAAGGAACTTTCAGG + Intronic
900754353 1:4423354-4423376 CCTGGGGAGAGGTTACTGTCAGG - Intergenic
901023527 1:6267199-6267221 CCTGAGGAGAGGCAACTTCCTGG + Intronic
902270682 1:15302242-15302264 AGTGGGGAGAAGGAACTGCCCGG + Intronic
903216662 1:21847285-21847307 CCTGGGGAGAAGGAACTTTCAGG - Intronic
903811634 1:26037965-26037987 CCTGGGGACAGGGAACTCTGTGG - Intronic
904458989 1:30664267-30664289 CCAGAGCAGAAGGAACTTGCTGG + Intergenic
904684193 1:32248706-32248728 GCGGGGGAGGAGGAACATTCAGG + Exonic
904949985 1:34229232-34229254 CCTGGGGAGGAGAGCCTTTCAGG + Intergenic
905524427 1:38625513-38625535 ACTGGGGAGAAGGGCCTTCCAGG - Intergenic
905919960 1:41712789-41712811 CCTGGGGAGAAGCAACAAACTGG + Intronic
906325873 1:44845357-44845379 CCTGGGGAAGAGGAACATTTAGG + Intergenic
907717540 1:56941137-56941159 CCTGTGGACAAGGAAGTGTCTGG - Intronic
907768360 1:57434497-57434519 AAGGGGTAGAAGGAACTTTCTGG + Intronic
908917120 1:69141811-69141833 CCTGGGTAGAATGATATTTCTGG - Intergenic
909070109 1:70983927-70983949 CCTGGGGACTAGGACCTTTCAGG - Intronic
910631007 1:89354304-89354326 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
912363340 1:109113028-109113050 GCGAGGGAGAAGGAAATTTCTGG - Intronic
913193393 1:116432541-116432563 TTTGGGGAGAAGGAAGTTCCAGG - Intergenic
913402128 1:118448251-118448273 CATGGAGATAAGGAACTTACTGG + Intergenic
915247532 1:154567423-154567445 CCTGGGGAGCAGGACCATTTGGG + Intergenic
915642442 1:157239243-157239265 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
915704947 1:157834724-157834746 ACTGGGGAGAAAGAGCTCTCTGG + Exonic
915923288 1:159995076-159995098 CATGGAGATAAGGAACTTGCTGG - Intergenic
915969497 1:160343649-160343671 GCGGGGGAGAAGGGACCTTCAGG - Intronic
917987007 1:180331026-180331048 CCTGGAGAGAAGAAACCTCCTGG - Intronic
918636037 1:186775345-186775367 CTTGGGCAGAAGGAAGTTTTTGG - Intergenic
919948540 1:202341158-202341180 CCTAAGGAGAAGAAACTGTCAGG - Intronic
920979521 1:210820333-210820355 ACAGGGTAGAAGGAACTTTGTGG + Intronic
922752657 1:228077918-228077940 CTGGGGGAGAGGGATCTTTCCGG - Intergenic
924678692 1:246207897-246207919 CCTGGGGAGCAGTAAATTTGGGG + Intronic
1062801573 10:385049-385071 CCTGAGGAGAAGCAGCTCTCAGG + Intronic
1063430389 10:5983325-5983347 CTTGGGGAGGAGGAACTTACGGG - Intergenic
1063724501 10:8621917-8621939 CTTGGGGAGAAGAAATGTTCAGG - Intergenic
1063918846 10:10911776-10911798 GCTAGGCAGAAGGAACTTACAGG + Intergenic
1064286502 10:13996057-13996079 CCTGGGGAGCACTCACTTTCTGG + Intronic
1067411452 10:46068412-46068434 ACTGGGGAGAAGGAAATTGGGGG - Intergenic
1067530538 10:47068505-47068527 GCTGGTGAGGAGGACCTTTCTGG + Intergenic
1070545839 10:77451788-77451810 CCTGGGGAGAAAAAACATCCAGG - Intronic
1070728164 10:78806635-78806657 CCAAGGGAGGAGGAACTTCCAGG - Intergenic
1073958604 10:108900163-108900185 CATGGGGAGAAGGAAATTGCAGG + Intergenic
1074261834 10:111861813-111861835 CTTAGGGAAAAGGAACTTCCAGG - Intergenic
1074287357 10:112110652-112110674 CCCAGGGAGAAGAAACTTCCTGG - Intergenic
1075403776 10:122180315-122180337 ACTGGGGGGAAGAAAGTTTCAGG - Intronic
1076687647 10:132205227-132205249 CCTGGGGACAGGGAACCTGCCGG + Exonic
1077324968 11:1959726-1959748 CCTTGGGAGATGCATCTTTCCGG - Intronic
1077438392 11:2555894-2555916 CCTGGGGAGAGAGAAGCTTCAGG + Intronic
1078416551 11:11170909-11170931 CCTGGGGAGAAGGTTCTCTGAGG + Intergenic
1078431516 11:11292041-11292063 CCAGGGGAGAAGCAGCTTGCCGG + Intronic
1079353842 11:19714215-19714237 CCTGGGGAGGAGGAAAGGTCGGG + Intronic
1079383346 11:19958069-19958091 CTTTGGGAGAAGGAAGTCTCAGG + Intronic
1079598496 11:22283859-22283881 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
1079776682 11:24540500-24540522 CCAGGTGAGAGGGCACTTTCTGG - Intronic
1079894570 11:26102635-26102657 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
1080412606 11:32039983-32040005 CCAGGGGAGAAAGAACATTCTGG - Intronic
1080867210 11:36205901-36205923 CCCAGGGAGCAGGAACTTCCAGG - Intronic
1083301771 11:61743444-61743466 CCTGGCTAAAAGGAACTTGCAGG - Intronic
1084005164 11:66318680-66318702 CCTTGTAAGAAGGAACTTCCAGG - Intergenic
1085815034 11:79728144-79728166 CCTAGGGAGATGGACCTTCCTGG + Intergenic
1088917012 11:114235122-114235144 TGTGGGGAGAAGAAGCTTTCGGG + Intronic
1088990406 11:114948696-114948718 CCTGAGGAGAAGCAAATTTGGGG + Intergenic
1089153931 11:116386124-116386146 CCTGGGAAGTGGGAACTTTCAGG - Intergenic
1089588851 11:119527256-119527278 CCTGGGGAGAAGGGAGCTGCAGG + Intergenic
1090717158 11:129440773-129440795 CCTGGGGAGATCTAACTATCAGG - Intronic
1090952127 11:131482899-131482921 CCTGGGAAAAAGGAAGCTTCAGG + Intronic
1091221089 11:133930548-133930570 GCTGGGCAGGAGGAAGTTTCTGG - Intronic
1202807950 11_KI270721v1_random:14905-14927 CCTTGGGAGATGCATCTTTCCGG - Intergenic
1091804026 12:3343236-3343258 CCTGGGGGGAAGGCACCTTGAGG - Intergenic
1091847972 12:3672136-3672158 TCTGGGGAGAAAGGACTTTTAGG - Intronic
1093831140 12:23760061-23760083 ACTTGGGAGAATGAACTCTCAGG - Intronic
1094096449 12:26710426-26710448 GATGGGGAGAAGGAGATTTCAGG - Intronic
1095162837 12:38937113-38937135 ACTGGGGAAAGGGAAATTTCGGG + Intergenic
1098102584 12:67034178-67034200 CCTGGGCAAAAGGAACCTGCTGG + Intergenic
1099449378 12:82790489-82790511 CCTGGGAAGAAGTAAATTGCTGG + Intronic
1100807964 12:98307450-98307472 GCTGAGGAGAAATAACTTTCTGG + Intergenic
1101310558 12:103575018-103575040 CCTGGATAAAATGAACTTTCTGG + Intergenic
1101498237 12:105276549-105276571 CCTGGGTAGAAGGAACCTGAGGG - Intronic
1102698026 12:114815293-114815315 CCTGCTGAGAAGGGACTTTGAGG - Intergenic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1106666875 13:31860575-31860597 CCTGGAAAGATGGAAATTTCAGG + Intergenic
1109810827 13:67509992-67510014 CATAGGGAGAAGGGACTTTGGGG + Intergenic
1109979220 13:69884684-69884706 CCTTGGGAGAAGTTTCTTTCAGG + Intronic
1110877520 13:80528155-80528177 CCCTGGGAGAAGAAACTTTCTGG + Intergenic
1110952458 13:81513970-81513992 CCCAGGGAAAAGCAACTTTCTGG + Intergenic
1116804051 14:49474400-49474422 TCTTGGGAGAAGGAACTCTTTGG - Intergenic
1118313410 14:64708864-64708886 CCTGTGATGAAGGAACTTCCTGG + Intronic
1119812177 14:77531388-77531410 CCTGTGAAGAAATAACTTTCAGG - Intronic
1121500172 14:94429291-94429313 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
1122637483 14:103137120-103137142 CAGGCTGAGAAGGAACTTTCAGG - Exonic
1122740980 14:103871603-103871625 CCTGGGGAGAAGGTGCTCCCTGG + Intergenic
1126111411 15:45177148-45177170 CCTGAAGAGAAAGAACATTCTGG + Intronic
1126365162 15:47886604-47886626 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
1127291354 15:57574121-57574143 AATGGGGAGAAAGAACTTGCAGG - Intergenic
1127371386 15:58345092-58345114 CCCAGGGAGAAGAAACTTCCTGG + Intronic
1128511355 15:68315814-68315836 CTTGGGGAGAGGGAGCTTGCTGG + Intronic
1128647959 15:69390936-69390958 TTTAGGGAAAAGGAACTTTCAGG - Intronic
1130709929 15:86270077-86270099 CTTGGGGAGCAGGGGCTTTCTGG + Intronic
1132243083 15:100275912-100275934 CCTGGGGACAGGGTACTGTCTGG + Intronic
1132462753 16:63490-63512 CCTGAGCAGAAGGGACTCTCTGG - Intronic
1135593388 16:23721803-23721825 ACAGGGCACAAGGAACTTTCTGG - Intergenic
1135932990 16:26755136-26755158 CCTGGGGAGCAGGAAAGTTCTGG - Intergenic
1138315728 16:56068405-56068427 CCTGAGGGGCAGGAACTATCTGG + Intergenic
1138360186 16:56421970-56421992 CCTTGGGAGGAGGAAGTTTTAGG + Intronic
1138827978 16:60343817-60343839 CCTGGAGAGATGGGTCTTTCAGG + Intergenic
1141638450 16:85328140-85328162 CCTGGTGAGAACGAGCTTCCTGG - Intergenic
1141651218 16:85394098-85394120 CCCTGGGAGAATGAACATTCGGG + Intergenic
1142249837 16:88986230-88986252 GCTAGCGAGAAGGAACTTCCAGG - Intergenic
1142389433 16:89789181-89789203 GCAGGTGAGAAGGAACTTTAAGG + Intronic
1142468817 17:151005-151027 CCTGGGGCCAGGGAACTTTCTGG + Intronic
1144038080 17:11385246-11385268 CCCGGGGAGAAGGGTCTTCCAGG + Intronic
1145208614 17:20997377-20997399 CCTGGGGTGGGGGAGCTTTCAGG - Intergenic
1146262618 17:31431848-31431870 CCTGGGGAGAATCAACTTCAAGG + Exonic
1146422098 17:32697036-32697058 GCTGGGGAGAGGACACTTTCTGG - Intronic
1148881956 17:50735405-50735427 CCTGTCTAGAAAGAACTTTCAGG + Intronic
1148899797 17:50866830-50866852 CCCGCGGAGAGGGCACTTTCTGG - Intronic
1149759696 17:59218306-59218328 GCTGGGGAGAAAGCACTTTTTGG + Intergenic
1151345253 17:73497523-73497545 CAGGCGGAGAAGGAGCTTTCTGG - Intronic
1152636292 17:81431836-81431858 CCTGGAGAGCAGGAGCTTGCGGG - Intronic
1153148277 18:2058208-2058230 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
1155973219 18:32101104-32101126 TCTGGGGAGAAGAAACATTCTGG + Intronic
1156291284 18:35750587-35750609 GCTGGGGAGAAGCAACTTCCTGG - Intergenic
1157722971 18:49939589-49939611 ACTGGGGAGAAGGAACCTACCGG + Intronic
1158352329 18:56575326-56575348 ACTGGTGAGAAGGAACTGTTCGG - Intergenic
1159019272 18:63129848-63129870 CCTGGGGAAAGGGAGCTGTCAGG + Intronic
1161459329 19:4387255-4387277 TCTGGCAAGAAGGAACTTCCAGG + Intronic
1162311145 19:9908050-9908072 CGTGGGGAGGGGGATCTTTCAGG - Intronic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1164601879 19:29567854-29567876 CCTGGGGACAGAGAACTTCCAGG + Intergenic
1164932104 19:32183845-32183867 CCTGGAGGGAATGAACCTTCTGG - Intergenic
1165264461 19:34648075-34648097 CCTGGGGAGAAGCAGGTTTAGGG + Intronic
1165745418 19:38227812-38227834 CCTGGGGAGAAGGAGCTGCAGGG - Intronic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
925215824 2:2095210-2095232 CCTGGGGAAAAGGGGCTTTCTGG + Intronic
925565489 2:5249570-5249592 CCTGGGGAAAAAGGACTTTGGGG - Intergenic
925916106 2:8607496-8607518 GCCTGGGAGAAGGAACTTGCTGG - Intergenic
926205905 2:10834339-10834361 TCTGTGGAGAGGGAACATTCTGG + Intronic
926833219 2:16988142-16988164 CCTAGGGAAAAGGTATTTTCTGG + Intergenic
930705701 2:54502771-54502793 CCTGTTGAGCAGGAACCTTCTGG + Intronic
936142153 2:109949628-109949650 CCTGGGCAGTAGTAAGTTTCAGG + Intergenic
936178843 2:110247587-110247609 CCTGGGCAGTAGTAAGTTTCAGG + Intergenic
936202535 2:110421845-110421867 CCTGGGCAGTAGTAAGTTTCAGG - Intronic
936964317 2:118112392-118112414 CCAGGGTAGGAGGAAGTTTCAGG + Intergenic
937869928 2:126779471-126779493 GCTGGTGAGAAGCAACTCTCAGG - Intergenic
939087422 2:137738125-137738147 GCTGGGGAGAATAAACTTCCTGG + Intergenic
939095526 2:137829413-137829435 CCTGAGGAGAAGGAGCCTTCAGG - Intergenic
940710376 2:157155480-157155502 CCCAGGGAGAAGCAACTTTTTGG + Intergenic
941645948 2:168041494-168041516 ACTGTAGAGAAGGAACTTTGGGG - Intronic
943674753 2:190705733-190705755 CATGGGAAGAGGGAACTTTAAGG + Intergenic
944272585 2:197800254-197800276 CCTGGGGCTAAGGCACTATCAGG - Intergenic
946276499 2:218635704-218635726 CCAGGGGAGAAGAAGCTTTTTGG - Intronic
947610010 2:231518929-231518951 CCTGGGGAGAAGGGTCTGACTGG - Intergenic
948043828 2:234927578-234927600 CCTGGGGATTAGGAATTTTGAGG - Intergenic
948557836 2:238826901-238826923 CCTGGGGAGACGGAGGTTGCAGG + Intergenic
948559163 2:238839262-238839284 TCTGGGGAGCAGGAAGTTTCAGG + Intergenic
948565707 2:238884803-238884825 CCCAGGGAGCAGGCACTTTCCGG - Intronic
949035821 2:241815347-241815369 CCTGGGGAGAGGGATTTGTCTGG - Intronic
1170699093 20:18687208-18687230 CCTAGGTAGAGGGAACTTCCAGG + Intronic
1171105623 20:22429941-22429963 CCTGGGTGGAAGAGACTTTCTGG + Intergenic
1171373570 20:24676701-24676723 CTTGGGCAGAAGGAGCCTTCAGG - Intergenic
1172248428 20:33462141-33462163 CCAGGGGAGAAGTAACTTCCAGG - Intergenic
1172652342 20:36512758-36512780 TCTGGGGAGAAGAACTTTTCAGG + Intronic
1175469953 20:59220455-59220477 CTAGGGGAGAAGTAACTTTAGGG + Intronic
1175838299 20:62010558-62010580 CCTGGGAGGATGGAGCTTTCAGG - Intronic
1175883569 20:62274623-62274645 TCTGGGAAGAAGGAGCTTGCTGG + Intronic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1176286008 21:5020147-5020169 CAAGGGGCTAAGGAACTTTCTGG + Intergenic
1178468447 21:32870556-32870578 CCTGGGGGGAAGGAAATTGGAGG - Intergenic
1179871173 21:44243328-44243350 CAAGGGGCTAAGGAACTTTCTGG - Intergenic
1179909464 21:44440392-44440414 ACTGGGGTGATGGAACGTTCTGG - Intronic
1180414019 22:12693041-12693063 CCTGGGGAGGACGCATTTTCTGG + Intergenic
1181452804 22:23035203-23035225 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
1184325769 22:43783101-43783123 CCTTGGGAGTAGGATCTTTCAGG - Intronic
1184673553 22:46028040-46028062 CCTGGGGCGTAGGACCCTTCTGG + Intergenic
949347359 3:3089170-3089192 CCTGGGGAGAGGGAACTGAAAGG - Intronic
950133497 3:10564056-10564078 CCTGGTGAGAAAGAAACTTCAGG + Intronic
950318161 3:12023911-12023933 CCTGGGGTAAAGGAGCTTTGGGG + Intronic
950654424 3:14427867-14427889 GCTGGGGAGATGGAAGTTACAGG - Intronic
950674002 3:14543813-14543835 CCTGGGGACATGGAAGTGTCAGG - Intergenic
950798491 3:15530650-15530672 GCTGGGGAGAAGGAGGTGTCAGG - Intergenic
951490318 3:23263057-23263079 GATGGAGAGAAGGAACTTTTAGG + Intronic
952820277 3:37480502-37480524 CCTGGCATGAGGGAACTTTCTGG + Intronic
953440333 3:42910622-42910644 CCTGAGGAATAGGAACTATCTGG - Intronic
953584174 3:44184954-44184976 ACTGGGCAGAAGGAAATTTAGGG + Intergenic
954217606 3:49133152-49133174 CCTGGGGCGAAGGCAGTTTCCGG - Intergenic
954908785 3:54085974-54085996 CCTGGGGTGAAGGAAGTTTCCGG - Intergenic
959791072 3:110362099-110362121 TCTGGGGAAAAGAAACTTGCAGG - Intergenic
960996993 3:123346784-123346806 CCTGGGGAGAAGGAACTCTCCGG + Intronic
961323739 3:126097311-126097333 CCCAGGGAGAAGCAACTTCCTGG - Intronic
963594056 3:147303285-147303307 CCTGTAGAGAAGAAACTTCCAGG - Intergenic
965889452 3:173492924-173492946 CCTGGGTAGAAGGAATTTTCTGG + Intronic
970826576 4:20283557-20283579 CCTGGTGAGAAGCATCATTCAGG - Intronic
971622004 4:28867070-28867092 CCTGGGGAGAATGGACTCTATGG + Intergenic
971860397 4:32094466-32094488 CCTAGGGAGAAGCAACTTCACGG - Intergenic
973930558 4:55789405-55789427 GCCAGGGAGAAGGAACTTCCTGG - Intergenic
975148178 4:70993252-70993274 TCTGGGGAGAAGGCACTGTGTGG - Intronic
975320155 4:73000954-73000976 CGTGGGGAGGAGGAAGTTACAGG + Intergenic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975908549 4:79244081-79244103 CCCAGGGAGAAGTAACTTCCTGG - Intronic
977138881 4:93341415-93341437 CCTGGGTACAAGCAACTCTCAGG + Intronic
978765465 4:112400833-112400855 CCAGGGGAGAGGGTACATTCTGG - Intronic
986330032 5:6711193-6711215 CCAGGGGATAAGGGACTTGCAGG + Intergenic
986650508 5:9959025-9959047 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
986680685 5:10230784-10230806 CCTGGGGAGGAGGAAGTGCCAGG - Intronic
990329989 5:54715795-54715817 CCAGGGGATGAGGATCTTTCAGG + Intergenic
990341090 5:54823686-54823708 CCCAGGGAGAAGAAACTTCCCGG + Intergenic
990521308 5:56584095-56584117 CCCAGGGAGAAGCAACTTCCTGG - Intronic
991311601 5:65249241-65249263 GCTGGGGAGAAGCAACTTCCTGG + Intronic
993394225 5:87362859-87362881 CATGGGTAGAAGAAACATTCTGG - Intronic
995429033 5:112054224-112054246 CATGGAGATAAGGAACTTTCTGG + Intergenic
995887828 5:116916256-116916278 CCTTGAGAAAAGTAACTTTCAGG - Intergenic
996138385 5:119873774-119873796 CTTAGGGAGAAGCAACTTCCTGG + Intergenic
996213470 5:120839899-120839921 CCCTGGGAGAAGCAACTTCCTGG + Intergenic
999596215 5:153207608-153207630 ACTTGGGAGAAGGAAGATTCTGG - Intergenic
1001412352 5:171520305-171520327 CCTGGGGAGATGGGAGTTTGTGG + Intergenic
1003201492 6:3965324-3965346 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
1003505170 6:6734716-6734738 CCAGGGGAGAAGAAATTTCCAGG - Intergenic
1004350000 6:14882647-14882669 CCTGGGGAGCAGGAGCTGTCAGG + Intergenic
1004769865 6:18769747-18769769 CCTGGGGAGAGGGACTTTTGGGG - Intergenic
1006104838 6:31710330-31710352 TCTGGGGAGAAGGAGCCATCAGG - Exonic
1006317040 6:33297391-33297413 TCTGGGGAGAAGGGGCTTTGGGG - Intronic
1007959862 6:45948947-45948969 GCTGGAGAGAAGGAACATACTGG + Intronic
1008516519 6:52324303-52324325 CCTAGGGATAAGCAACTTCCTGG - Intergenic
1008962678 6:57281706-57281728 CCTGGGCAGATGGGACTTTCAGG + Intergenic
1010010383 6:71041630-71041652 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
1010462514 6:76129451-76129473 GCAGGGGAGAAGGAACCTTCAGG + Intergenic
1013169273 6:107621592-107621614 CCTGGGGAGAAGGAATAATTTGG - Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1014743825 6:125176348-125176370 CTTGGGGAGATGGCACATTCAGG - Intronic
1015018049 6:128438002-128438024 TATGGGGAGAAGCAACTTTTCGG - Intronic
1017975445 6:159353088-159353110 TCTGGGGAGAAGGGACTTTCTGG - Intergenic
1019353659 7:567921-567943 CCTGGGAAGATGAAACATTCTGG + Intronic
1019804277 7:3111584-3111606 AAAGGGGAGAAAGAACTTTCTGG + Intergenic
1020321332 7:6940739-6940761 CCTGGGCTCAAGCAACTTTCAGG - Intergenic
1023367244 7:39475933-39475955 GCCAGGGAGTAGGAACTTTCTGG - Intronic
1023881029 7:44321536-44321558 GCTGGGGAGAAGGGCCTTTCTGG + Intronic
1024436697 7:49364930-49364952 TCTGGTGAGAAACAACTTTCTGG - Intergenic
1024836770 7:53529873-53529895 CTGGGGGAGATGGAAGTTTCTGG - Intergenic
1028360809 7:89964350-89964372 GCCAGGGAGAAGGAACTTCCTGG + Intergenic
1030606309 7:111642458-111642480 CCCAGGGAGAAGAAACTTCCTGG + Intergenic
1031631457 7:124048357-124048379 CCCAGGGAGAAGCAACTTTGTGG + Intergenic
1034032503 7:147783754-147783776 AAAGGGGAGAAGGAACTCTCTGG - Intronic
1034372972 7:150616159-150616181 CCTGGGATGATGGAACTTGCTGG + Intergenic
1034990772 7:155546859-155546881 CCTGGGGAGAAGGGATTTTAGGG - Intergenic
1036621556 8:10427557-10427579 TCTGGGGAGAAGGACCCTGCTGG - Intronic
1036704451 8:11036246-11036268 CCTGGTAAGAAGGAACTTCCAGG - Intronic
1037617288 8:20531013-20531035 CCAAGGGAGAAGGAACTTCAAGG - Intergenic
1038672449 8:29593190-29593212 TCTGGGGAGAAAGAACAATCAGG - Intergenic
1039173891 8:34781660-34781682 GCTGGGGCTAAGGAACTTTATGG - Intergenic
1040917413 8:52577442-52577464 CCTTGGGATAATGAACTCTCAGG + Intergenic
1041024526 8:53670244-53670266 CCTGGGGAGGAGGAACCAGCAGG - Intergenic
1041755326 8:61307410-61307432 TCTGGGGAGAAAGAACCTCCTGG - Intronic
1046219298 8:111192654-111192676 CCCAGGGAGAAGCAACTTCCTGG + Intergenic
1046302918 8:112321475-112321497 CCTGGGGAGAAGAGCATTTCAGG + Intronic
1047602260 8:126437659-126437681 CTGGGGGAAAAGTAACTTTCAGG - Intergenic
1049175314 8:141189161-141189183 GCTGGGGAGAAGGGACTGTTTGG + Intronic
1049259040 8:141629107-141629129 CCTGGGGAAAAGCAACTAACAGG + Intergenic
1049358077 8:142198572-142198594 CCTCGGGAGAAGGCAGCTTCCGG - Intergenic
1050171493 9:2824106-2824128 CCTTGGAAGAAGGATCTGTCTGG - Intronic
1051721215 9:20039413-20039435 CCAGGGCAGGAGGAAATTTCTGG + Intergenic
1052536607 9:29755731-29755753 CATGGGGAGAATGAGCTCTCTGG + Intergenic
1052796042 9:32924425-32924447 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
1053114253 9:35488248-35488270 CTCAGGGAGAAGCAACTTTCTGG - Intergenic
1053462299 9:38280390-38280412 CCTGGGAAGAAGGGAGTCTCAGG - Intergenic
1056961779 9:91131478-91131500 AATGGGGAGAAGGAAGATTCAGG - Intergenic
1059508412 9:114820600-114820622 CCAGAGGAGAAGGATCGTTCTGG - Intergenic
1059598040 9:115744344-115744366 CCCAGGGAGAAGAAACTTCCTGG - Intergenic
1059964432 9:119599882-119599904 CCTAGGGAGAAGGAACATGTGGG + Intergenic
1060051297 9:120380182-120380204 CCAGGTGAGAAGGCACTTTGGGG - Intergenic
1060995987 9:127875155-127875177 CCTGGGGTGAAGGAATCTACAGG + Intronic
1061163878 9:128911423-128911445 CCTGGGGAGAAGCCACATTTGGG + Intronic
1061413280 9:130432338-130432360 CGTGGGGAGAAGTACCTTTGGGG - Intronic
1062074632 9:134578960-134578982 CTTGGGGTGAGGGGACTTTCTGG - Intergenic
1062205859 9:135336733-135336755 GCTGGGGAGAAGGAGCCGTCAGG + Intergenic
1062381615 9:136289632-136289654 CATGGGGAGATGGAATGTTCCGG + Intronic
1062663307 9:137651823-137651845 CCTGGGCAATAGGAACTTTTCGG - Intronic
1185676758 X:1855690-1855712 CCTGGGGAGAACCCACTTCCTGG + Intergenic
1187448603 X:19378082-19378104 CTTGGGCAGAAGGAACTTGGAGG - Intronic
1187930189 X:24286640-24286662 CCCAGGGAAAAGGAACTATCAGG - Intergenic
1189686328 X:43567612-43567634 GCTGAGGAAAAGGAAATTTCAGG - Intergenic
1189994494 X:46625897-46625919 TCTGGGGAGAAGCCACTTCCAGG - Intronic
1190705145 X:53021184-53021206 ATTGGGGAGAAGAAACCTTCTGG + Intergenic
1194398800 X:93418696-93418718 CCCAGGGAGAAGAAACTTTCTGG - Intergenic
1196366017 X:114925293-114925315 CATTGGGAGAAGTCACTTTCAGG + Intergenic
1196419918 X:115510784-115510806 CCCAGGGAGAAGCAACTTCCTGG - Intergenic
1198975114 X:142327591-142327613 CATGGGGAGGTGGAAGTTTCAGG + Intergenic
1200009371 X:153109547-153109569 CCAAGGGAGAAGCAACTTCCTGG + Intergenic
1200030229 X:153290375-153290397 CCAAGGGAGAAGCAACTTCCTGG - Intergenic
1200268960 X:154663055-154663077 CCCAGGGAGAAGAAACTTTCTGG + Intergenic
1201176026 Y:11308547-11308569 CCAGGGGAGGATGCACTTTCCGG - Intergenic