ID: 903217840

View in Genome Browser
Species Human (GRCh38)
Location 1:21852888-21852910
Sequence GCCCCCCGGGACCACCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903217840_903217849 4 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217849 1:21852915-21852937 ATACCTGGTGCCGGGCAGGGAGG 0: 1
1: 3
2: 2
3: 52
4: 507
903217840_903217844 -5 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217844 1:21852906-21852928 GGGGCTGCCATACCTGGTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 190
903217840_903217847 1 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217847 1:21852912-21852934 GCCATACCTGGTGCCGGGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 179
903217840_903217846 0 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217846 1:21852911-21852933 TGCCATACCTGGTGCCGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 104
903217840_903217845 -4 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217845 1:21852907-21852929 GGGCTGCCATACCTGGTGCCGGG 0: 1
1: 0
2: 4
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903217840 Original CRISPR GCCCCCCGGGACCACCTTGC TGG (reversed) Intronic