ID: 903217840

View in Genome Browser
Species Human (GRCh38)
Location 1:21852888-21852910
Sequence GCCCCCCGGGACCACCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903217840_903217845 -4 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217845 1:21852907-21852929 GGGCTGCCATACCTGGTGCCGGG 0: 1
1: 0
2: 4
3: 20
4: 188
903217840_903217847 1 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217847 1:21852912-21852934 GCCATACCTGGTGCCGGGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 179
903217840_903217846 0 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217846 1:21852911-21852933 TGCCATACCTGGTGCCGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 104
903217840_903217844 -5 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217844 1:21852906-21852928 GGGGCTGCCATACCTGGTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 190
903217840_903217849 4 Left 903217840 1:21852888-21852910 CCAGCAAGGTGGTCCCGGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 903217849 1:21852915-21852937 ATACCTGGTGCCGGGCAGGGAGG 0: 1
1: 3
2: 2
3: 52
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903217840 Original CRISPR GCCCCCCGGGACCACCTTGC TGG (reversed) Intronic
900197135 1:1382139-1382161 TCCCCCAGGGATCACCTTCCTGG - Intergenic
900900858 1:5514768-5514790 GGCCCCCAGGCCGACCTTGCAGG + Intergenic
902242841 1:15100248-15100270 GCATCCCGTGACCACCCTGCTGG - Intronic
902389174 1:16092791-16092813 GCACCATGGGATCACCTTGCAGG - Intergenic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
903228023 1:21904724-21904746 ACCCCCAGGGACCTTCTTGCTGG - Intronic
905281586 1:36852796-36852818 GCTCCCAGGGACCCACTTGCTGG + Intronic
914802942 1:150974090-150974112 GCCCACCGTGCCCACCTCGCAGG - Intronic
914922446 1:151856613-151856635 TCCTCCTGGGGCCACCTTGCTGG - Intergenic
917749023 1:178037849-178037871 GCACCCTGGGACTGCCTTGCGGG + Intergenic
918194297 1:182207205-182207227 GCCCCCTTGCCCCACCTTGCTGG - Intergenic
919265096 1:195252390-195252412 GCCCCCAGGGACCAGTTTCCTGG - Intergenic
919871055 1:201821807-201821829 GCCCCGCGGGACCAGCTTCTAGG + Exonic
921934905 1:220787147-220787169 GCTCACCGGCACCCCCTTGCAGG - Exonic
923372343 1:233327350-233327372 GCCCCCTGGGCCCGCCTGGCTGG - Intergenic
1063094937 10:2900737-2900759 GCGCCCCGGGAAGACCATGCTGG + Intergenic
1064028811 10:11870003-11870025 GCCCCCTGGGGCCCCCTCGCCGG - Exonic
1070152076 10:73811365-73811387 GCCGCCCGGGACGACCCTGCGGG + Intronic
1075091546 10:119446669-119446691 GCCCCCACGGACCACCAGGCTGG - Intronic
1076164747 10:128272722-128272744 GCCCTCAGGGACCACGCTGCAGG + Intergenic
1076293713 10:129367788-129367810 GCCTGCCGGGACCACCCTGCAGG + Intergenic
1076530336 10:131140660-131140682 GACCCCAGAGAGCACCTTGCAGG + Intronic
1077032748 11:477045-477067 GCCCACAGGGACCACCTTTCTGG - Intronic
1077080472 11:722606-722628 GCCCACCAGGACCCCCTTGCTGG - Intronic
1083886734 11:65576714-65576736 GCCACCCTGAACCACCTTTCTGG - Intronic
1084118795 11:67056952-67056974 GCCCACCAGGACCACCTTGACGG - Exonic
1084727148 11:70949343-70949365 GCCCCCGGGGAGCTGCTTGCCGG - Intronic
1092168045 12:6355082-6355104 TCCCCCAGGGTCCACCCTGCAGG + Intronic
1096482613 12:51952217-51952239 GCCCCCCAGGAGCACCTGGAGGG - Intronic
1097181998 12:57177174-57177196 GACCCTCCGGACCACCCTGCTGG + Exonic
1103927217 12:124429688-124429710 GCCCCGCTGGCCCACCCTGCTGG + Exonic
1104919666 12:132283917-132283939 GACCCCCGAGACCACCTTGACGG - Intronic
1105306723 13:19174118-19174140 TCCCCCAGGGACCACCGTGGGGG + Exonic
1108412262 13:50161633-50161655 GCCCCATTGGACCACCTTACTGG + Intronic
1112509696 13:99998064-99998086 GCCCTCCGGGCCCACCTTGGCGG + Intergenic
1113749770 13:112769125-112769147 GCCCCCCGGCTCCTCCTTCCAGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114519048 14:23321573-23321595 GCCCCCCGGGGCCCCCTCCCCGG - Exonic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1122720841 14:103721440-103721462 GGCCTCCGTGGCCACCTTGCAGG - Intronic
1122825310 14:104367790-104367812 GCCCCCCGGGACAAGCTCGAGGG - Intergenic
1123689645 15:22827345-22827367 GCCCCCCTGGAGCATCTTCCCGG + Exonic
1125768519 15:42150433-42150455 GCCCCCCTCGCCCAGCTTGCTGG + Exonic
1129666732 15:77583339-77583361 GCTCCCGGGTAACACCTTGCAGG + Intergenic
1129679607 15:77650768-77650790 GCCCTCTGTGACCACCCTGCAGG - Intronic
1132426634 15:101723924-101723946 GCCACACGGGACCACCGAGCAGG + Intronic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1133347655 16:5081215-5081237 GGCCCCTGGGGCCACCTGGCAGG - Intronic
1137588111 16:49676569-49676591 GTCCACCGAGACCACCTTGCAGG + Intronic
1139952965 16:70680854-70680876 TCTCCCCAGGACCACCGTGCTGG - Exonic
1142984696 17:3688875-3688897 GCCCCTCGAGACCACCCTCCAGG + Intronic
1144830502 17:18128424-18128446 CGCCCCCAGGATCACCTTGCTGG - Intronic
1145236927 17:21214681-21214703 GCCGCCCGGGCCCTCCTTGGAGG + Intergenic
1146654481 17:34626896-34626918 GCCCCCCAGGAGGACCCTGCAGG + Exonic
1151242823 17:72771503-72771525 GCCCTCCAGGCTCACCTTGCAGG + Intronic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152642346 17:81454484-81454506 GTCCCCAGGGACCCCGTTGCCGG - Intronic
1158968592 18:62644951-62644973 GCCCCACGGCAGCATCTTGCAGG - Intergenic
1160571207 18:79818772-79818794 GCCCCCACGGAGCACCCTGCTGG - Intergenic
1160696770 19:488809-488831 GCCTCCCGGGACCAGCGCGCTGG + Intergenic
1160853586 19:1206149-1206171 GGCCCCGGCGACCACCTTGGGGG + Intronic
1160921990 19:1525360-1525382 GCCACACGGCACCACCTTGAGGG - Exonic
1161959506 19:7516110-7516132 GCTCCCCGGGAGCGCCTGGCGGG + Exonic
1162088416 19:8262180-8262202 GCGCCCCTGGGCCACCTTTCTGG + Exonic
1162386408 19:10362657-10362679 GTCCCCCTGGACCACCTTCCAGG - Exonic
1167651902 19:50735938-50735960 GCCCCCGGGAACCAACTTGGTGG - Intergenic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167924153 19:52809929-52809951 GCCCCCCGGGGCAACCTCCCCGG - Intronic
925646026 2:6037620-6037642 CCACCCCGAGGCCACCTTGCTGG - Intergenic
928410725 2:31052074-31052096 GCTCCACGGGACCATCCTGCTGG + Intronic
929188585 2:39120416-39120438 GCGCCCCGGGGGCACCATGCAGG - Exonic
929760571 2:44802819-44802841 GCCCCCGAGGGCCGCCTTGCGGG + Intergenic
930022243 2:47008501-47008523 CACTCCCGGGGCCACCTTGCTGG - Intronic
934664192 2:96158516-96158538 GCCCCCCTGCCCCACCTAGCTGG + Intergenic
936083768 2:109452888-109452910 GCCTCCCGGGACCAGCCTCCTGG - Intronic
936083778 2:109452916-109452938 GCCTCCCGGGACCAGCCTCCTGG - Intronic
936524982 2:113235972-113235994 GACCCCTCGGCCCACCTTGCGGG + Intronic
936525012 2:113236061-113236083 GACCCCTCGGCCCACCTTGCGGG + Intronic
938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG + Intergenic
946060495 2:216936907-216936929 GCCCCCAGGGACTACTCTGCTGG - Intergenic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1168777750 20:462282-462304 GCCCCCCGGGCCGCCCTCGCAGG + Intronic
1175701248 20:61138814-61138836 CCCCTCAGGGACCTCCTTGCTGG - Intergenic
1176057006 20:63154377-63154399 CCTCCCAGGGACCACCGTGCAGG + Intergenic
1180041447 21:45282313-45282335 GCCCCCCGGGAGCAGCCTGGAGG - Intronic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1181313099 22:21956057-21956079 CCCCCCCTGGACCCCCTTCCTGG - Intergenic
1182143458 22:27982343-27982365 GCGCACCGAGACCACCTCGCTGG - Exonic
1183220195 22:36507134-36507156 GCACGCCGGGACCAGCTGGCAGG + Intergenic
1183578247 22:38706140-38706162 GCCGCCCGGGCCTACCTTGCTGG - Exonic
1184652674 22:45926271-45926293 GCCCCAAGAGACCACCTGGCAGG + Intronic
952376227 3:32769916-32769938 GCCCCCTGAGGCCATCTTGCTGG + Exonic
968888604 4:3353174-3353196 GCCCTCTGGGACTACTTTGCTGG + Intronic
969585197 4:8087538-8087560 GCCACCCGGGACCCCTTTGGGGG - Intronic
971045164 4:22798021-22798043 TACACCCAGGACCACCTTGCTGG - Intergenic
985644628 5:1079101-1079123 GCCCCGCGGGCCCAGCCTGCCGG + Intronic
985908796 5:2863366-2863388 GCCCCCAGGGCCCACATTCCTGG - Intergenic
997890516 5:137672298-137672320 GCCTCCCACAACCACCTTGCTGG + Intronic
1004099608 6:12595445-12595467 ACCTCACGGGACCACTTTGCAGG - Intergenic
1006655016 6:35583582-35583604 CCCCCCAGGGAACACCTGGCAGG + Intronic
1007408618 6:41648901-41648923 GACCCCCGGGTCCCCATTGCAGG - Intronic
1014802237 6:125790558-125790580 GCCCCCCGCGACCTCCGAGCTGG - Intronic
1017719863 6:157236577-157236599 GCGCCCCGGGTCCACCTCGGCGG - Intergenic
1019395835 7:817057-817079 GCCCGCCTGGACCCCGTTGCGGG + Intronic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1020987617 7:15156149-15156171 GCCTCCCGCCATCACCTTGCTGG - Intergenic
1021975955 7:26011203-26011225 CGCCACCGGGACCACATTGCAGG + Intergenic
1022285842 7:28956008-28956030 GCTCCCCGGGACCACTGCGCGGG - Exonic
1024069520 7:45774530-45774552 TAGCCCCTGGACCACCTTGCAGG - Intergenic
1024881828 7:54095427-54095449 CCCTCCCTGGACCACCTTCCAGG - Intergenic
1032080932 7:128858131-128858153 GCCCCGAGTCACCACCTTGCTGG - Exonic
1032091316 7:128913029-128913051 GCCCCGAGTCACCACCTTGCTGG + Intergenic
1035383037 7:158452522-158452544 GCCGCCCGGGACAAGGTTGCAGG - Intronic
1035524121 8:298903-298925 TCTCCACGGGACCACCTTCCAGG + Intergenic
1035578911 8:727800-727822 GCACCACTGGACCACCTTGATGG + Intronic
1036846856 8:12175895-12175917 GCCCCCCGCTAACTCCTTGCCGG + Intergenic
1036868222 8:12418214-12418236 GCCCCCCGCTAACTCCTTGCCGG + Intergenic
1038087620 8:24217338-24217360 GCCCCAAGGGACCAACTTTCAGG + Intergenic
1049160862 8:141096645-141096667 GTCCCCTGGGAGCACCTGGCTGG - Intergenic
1049657139 8:143803926-143803948 GCCCCGCGGGAGCACCTGTCAGG + Exonic
1049782276 8:144434502-144434524 ACCCCCCGGGACAAGCTTTCTGG + Intronic
1054763991 9:69027349-69027371 GCACCCCGGGGCCACTTTGGTGG - Intergenic
1054775376 9:69120501-69120523 GCCCAGTGGGTCCACCTTGCCGG - Intergenic
1056714132 9:89014281-89014303 GACCCCAGGGACCACAGTGCAGG - Intronic
1058670976 9:107360162-107360184 AACCCACGGGACCATCTTGCAGG - Intergenic
1060794987 9:126507322-126507344 CCCCACCGGGGCCACCTGGCAGG - Intergenic
1061755927 9:132812635-132812657 GCTCCTCAGGACGACCTTGCAGG + Intronic
1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG + Intronic
1062359476 9:136180785-136180807 GCCCTCCTGGCCCACCTTGACGG + Intergenic
1186523228 X:10223818-10223840 GCCCCTGTGGACCACCTAGCAGG - Intronic
1192473701 X:71420874-71420896 GCCCCCCGGGGCCCCCTCCCCGG + Intronic