ID: 903219659

View in Genome Browser
Species Human (GRCh38)
Location 1:21862091-21862113
Sequence ATGCCAGCACAACGCCGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903219659_903219667 2 Left 903219659 1:21862091-21862113 CCCCTGCGGCGTTGTGCTGGCAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 903219667 1:21862116-21862138 CTGCAGGGCACAAGGAGGGCAGG 0: 1
1: 0
2: 2
3: 57
4: 486
903219659_903219665 -3 Left 903219659 1:21862091-21862113 CCCCTGCGGCGTTGTGCTGGCAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 903219665 1:21862111-21862133 CATTGCTGCAGGGCACAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 170
903219659_903219666 -2 Left 903219659 1:21862091-21862113 CCCCTGCGGCGTTGTGCTGGCAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 903219666 1:21862112-21862134 ATTGCTGCAGGGCACAAGGAGGG 0: 1
1: 0
2: 0
3: 26
4: 208
903219659_903219668 16 Left 903219659 1:21862091-21862113 CCCCTGCGGCGTTGTGCTGGCAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 903219668 1:21862130-21862152 GAGGGCAGGCACCAGCCATTAGG 0: 1
1: 0
2: 0
3: 42
4: 346
903219659_903219664 -6 Left 903219659 1:21862091-21862113 CCCCTGCGGCGTTGTGCTGGCAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 903219664 1:21862108-21862130 TGGCATTGCTGCAGGGCACAAGG 0: 1
1: 0
2: 3
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903219659 Original CRISPR ATGCCAGCACAACGCCGCAG GGG (reversed) Exonic
903219659 1:21862091-21862113 ATGCCAGCACAACGCCGCAGGGG - Exonic
905466593 1:38158961-38158983 ATGCCAGCACCACTACCCAGGGG + Intergenic
915544844 1:156591345-156591367 ATGCCTGCAAACCGTCGCAGAGG - Intergenic
916872591 1:168933132-168933154 ATGCCAGGACAAGGAGGCAGAGG - Intergenic
919537177 1:198802055-198802077 ATGCCTGCAAAAGGCAGCAGCGG + Intergenic
922645324 1:227280896-227280918 ATCCCAGCACAACAGCTCAGGGG + Intronic
1074379250 10:112965332-112965354 ATGCCAGCAGAATGCAGTAGAGG + Intronic
1076396623 10:130142945-130142967 GTGCCAGCACCACACCGCAAAGG - Intronic
1077466623 11:2736574-2736596 ATGCCAGCTCATCGCCATAGCGG + Intronic
1085761270 11:79243520-79243542 ATGACAACAAAACGCTGCAGGGG + Intronic
1090200072 11:124847615-124847637 AGGACAGCCCAAGGCCGCAGAGG - Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1106489675 13:30208327-30208349 ATACCAGCACAAAGCCGGGGAGG + Exonic
1112099655 13:96174210-96174232 ATGCCAGCTCCACTCCTCAGAGG + Intronic
1117492753 14:56268581-56268603 ATGTGAGCAAAATGCCGCAGGGG - Intronic
1118665557 14:68065393-68065415 AGGCCAGCACATGGCCCCAGGGG - Intronic
1132837677 16:1962626-1962648 GTACCAGCACAGAGCCGCAGCGG + Exonic
1133006214 16:2883166-2883188 ACGCCAGCTCTACGCCGCACGGG + Exonic
1137841890 16:51648686-51648708 GGGCCAGCCCAACCCCGCAGAGG - Intergenic
1141134450 16:81456582-81456604 ATGACAGCACCACCTCGCAGGGG - Intronic
1151923389 17:77174640-77174662 AGGCCACCACAACGAGGCAGTGG + Intronic
1153369210 18:4294951-4294973 ATGGCAGAACAATGCAGCAGAGG - Intronic
1153970065 18:10217919-10217941 ATGCCAGCACAATGCCAGAGGGG - Intergenic
1160903128 19:1438980-1439002 GTGCCCGCCCACCGCCGCAGAGG - Intronic
927190870 2:20516098-20516120 GTGCCAGCACATCCCTGCAGAGG + Intergenic
938371147 2:130768965-130768987 TTCCCAGCACAACGTGGCAGTGG - Intergenic
939890896 2:147735062-147735084 ATGCCAGCACAATGCTGCTTTGG - Intergenic
945182567 2:207106886-207106908 ATGCCAGCATAATGCTGCAGGGG + Intronic
1169065865 20:2693761-2693783 ACGCCAGCACCGCGGCGCAGAGG + Exonic
1169357219 20:4917414-4917436 ATGCCATCACAGCACAGCAGGGG + Intronic
1170429588 20:16264074-16264096 ATGCCAGCACACCCCTTCAGGGG + Intergenic
1175893160 20:62324180-62324202 CTGCCAGCACAACACCGAAGGGG - Exonic
1181531610 22:23520651-23520673 CAGCCAGCACAGGGCCGCAGTGG + Intergenic
950899198 3:16482019-16482041 AAGCCAGCACTACGCTCCAGTGG + Intronic
952752097 3:36832927-36832949 TTGGCTTCACAACGCCGCAGAGG + Exonic
969095307 4:4728523-4728545 ATGCCAGCTCAGAGCCACAGGGG - Intergenic
985401777 4:189600433-189600455 ATGGCAGCACAACACAGCACAGG + Intergenic
993075823 5:83229277-83229299 CTGCCAGCACAATGCCTGAGAGG - Intronic
1004841271 6:19587719-19587741 ATGCCAGTAGAACGAAGCAGTGG - Intergenic
1007320978 6:41028564-41028586 CTGCCAGCGCAGCCCCGCAGCGG - Exonic
1011521307 6:88209575-88209597 ATGCCAACAGAACACAGCAGAGG + Intergenic
1024812435 7:53227993-53228015 TTGCCTGCCCAAGGCCGCAGAGG - Intergenic
1028979058 7:96946612-96946634 ATGCAAGCACAAGCCTGCAGAGG - Intergenic
1035035824 7:155893127-155893149 ATTCCTGCAAAACGCCACAGGGG - Intergenic
1036471286 8:9055101-9055123 ATGCCAGCACAGCCCCGTGGTGG + Intronic
1037889389 8:22615545-22615567 GTGCCAGCAGAAAGCTGCAGAGG + Exonic
1038941574 8:32311471-32311493 ATGCAAGCACAAGGCCCTAGAGG + Intronic
1049367624 8:142248355-142248377 ATGCCCGCACAGCTCCCCAGAGG + Intronic
1054162042 9:61680453-61680475 ATGCCAACACACAGCCACAGAGG + Intergenic
1055147591 9:72955363-72955385 ATGCCAGGACTATGCAGCAGAGG + Intronic
1058023592 9:100117054-100117076 ACACCAGCACAGAGCCGCAGCGG + Intronic
1061248896 9:129415133-129415155 CAGCCAGCACAGGGCCGCAGTGG - Intergenic
1203456921 Un_GL000219v1:176733-176755 ATGCCAGAACACTGCTGCAGGGG - Intergenic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1195134476 X:101890690-101890712 ATGCGAGCACAAAGAAGCAGGGG + Intronic