ID: 903220249

View in Genome Browser
Species Human (GRCh38)
Location 1:21865362-21865384
Sequence TGCCCTGGAAAGACACCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903220247_903220249 -5 Left 903220247 1:21865344-21865366 CCACTAGCATGATGTTGTTGCCC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG 0: 1
1: 0
2: 2
3: 51
4: 272
903220245_903220249 17 Left 903220245 1:21865322-21865344 CCCTGCAGCGCTGGCTGGGAGGC 0: 1
1: 0
2: 2
3: 29
4: 268
Right 903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG 0: 1
1: 0
2: 2
3: 51
4: 272
903220239_903220249 30 Left 903220239 1:21865309-21865331 CCTCCTCTCAGGGCCCTGCAGCG 0: 1
1: 0
2: 0
3: 40
4: 316
Right 903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG 0: 1
1: 0
2: 2
3: 51
4: 272
903220246_903220249 16 Left 903220246 1:21865323-21865345 CCTGCAGCGCTGGCTGGGAGGCC 0: 1
1: 0
2: 1
3: 35
4: 337
Right 903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG 0: 1
1: 0
2: 2
3: 51
4: 272
903220240_903220249 27 Left 903220240 1:21865312-21865334 CCTCTCAGGGCCCTGCAGCGCTG 0: 1
1: 0
2: 2
3: 33
4: 291
Right 903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG 0: 1
1: 0
2: 2
3: 51
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903220249 Original CRISPR TGCCCTGGAAAGACACCAGC AGG Exonic
901656617 1:10773231-10773253 GGCCCTGGGAAGACAGCAGCAGG + Intronic
903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG + Exonic
903557326 1:24203223-24203245 GGCCCTGGAAAGGGCCCAGCAGG + Intergenic
903594433 1:24483274-24483296 TGTCCTGGAAAGGCCCCCGCTGG - Intergenic
904978878 1:34479940-34479962 TGCCATGGAAACACCTCAGCCGG - Intergenic
905245032 1:36606798-36606820 TTCCCTGCATAGACACCAGGAGG + Intergenic
906800261 1:48730952-48730974 TGCTTTGGAAAGACAAAAGCAGG - Intronic
906948092 1:50312873-50312895 TGGACTGGAAAGATCCCAGCGGG - Intergenic
908757151 1:67479512-67479534 TGGCCTGGACAGAGGCCAGCTGG - Intergenic
909848867 1:80434514-80434536 TGACCTAGGGAGACACCAGCTGG - Intergenic
910384273 1:86664654-86664676 TGACCTAGTGAGACACCAGCTGG + Intergenic
910801219 1:91148746-91148768 TGACCTAGTGAGACACCAGCTGG - Intergenic
912457786 1:109809235-109809257 CTCCCAGGAAAGGCACCAGCGGG + Intergenic
912598471 1:110903269-110903291 TGACCTACTAAGACACCAGCTGG + Intergenic
912723211 1:112037362-112037384 TGCTCTGGAAAGGTGCCAGCCGG + Intergenic
913533592 1:119750477-119750499 TGCCTTGGAAAGGCAAAAGCTGG - Intronic
915578233 1:156795724-156795746 AGCACTGGAAAGACTACAGCTGG - Intronic
916321741 1:163512518-163512540 TGACCTAGTGAGACACCAGCTGG + Intergenic
918011501 1:180591268-180591290 TGCCCTGGAAAACCACCTGCAGG - Intergenic
918386578 1:184014079-184014101 TGAGCTGGAGAGACACCATCAGG + Intronic
920299570 1:204980318-204980340 TGCCCTGGAAAGGCACAAATTGG + Intronic
920934403 1:210417852-210417874 AGCCCTGGAAAAACCCAAGCGGG - Intronic
922751984 1:228074337-228074359 TGCCCAGGAAAGGAACCTGCAGG + Exonic
923518797 1:234720371-234720393 TGCCCTGGAAAGGCCACAGTTGG + Intergenic
923737804 1:236628007-236628029 AGCCCTGGAAGGACAGGAGCAGG + Intergenic
1062969004 10:1631430-1631452 CGCCCTGGCATGACACCAGCTGG - Intronic
1063467557 10:6257226-6257248 TGATCTGAAAATACACCAGCAGG + Intergenic
1064337583 10:14457841-14457863 AGCCAGGGAAAGACAGCAGCAGG - Intronic
1065735075 10:28744001-28744023 TTCCCTGGAAAATCACCAGCAGG + Intergenic
1069679979 10:70277537-70277559 TGTGCTGGAGGGACACCAGCTGG + Intronic
1070450705 10:76554322-76554344 TGATCTGAAAAGACACCATCAGG - Intronic
1072089255 10:92111038-92111060 TGCTCTGGAAAAGCAACAGCTGG + Intronic
1072853713 10:98924712-98924734 TGACCTAGGGAGACACCAGCTGG - Intronic
1074038277 10:109762453-109762475 TGACCTAGTGAGACACCAGCTGG - Intergenic
1076215557 10:128690884-128690906 TGCCCTGGAAGGTGACCATCTGG - Intergenic
1076624407 10:131812729-131812751 TGCCCGGCAAAGACACCAGCAGG + Intergenic
1076631870 10:131856479-131856501 TGCCCTGGAAAGTCAGGAGCGGG + Intergenic
1076941662 10:133614133-133614155 TTCCCTTGAAAGACATCAGACGG + Intergenic
1077185398 11:1233461-1233483 GGCCCTGGGAGGACACCTGCTGG + Intronic
1080192560 11:29569593-29569615 AGCCCTGGAAAGTCATCAGAGGG - Intergenic
1080707211 11:34707633-34707655 TGACCTAGGAAGACACCAGCTGG - Intergenic
1081482959 11:43506095-43506117 TGACCTGAAGAGACACCAGTCGG - Intergenic
1081853694 11:46290852-46290874 TGCACTGGAAGGGCCCCAGCTGG + Intronic
1084143848 11:67252871-67252893 GCCCCTGGAAAGACAGCGGCAGG - Intronic
1085194813 11:74662678-74662700 TGACCTAGTGAGACACCAGCTGG - Intronic
1085223372 11:74895569-74895591 TGACCTAGAGAGACACCAGCTGG + Intronic
1085764328 11:79269990-79270012 GGCCCTGGAAAGGAACCTGCTGG - Intronic
1087224761 11:95586178-95586200 TGCCCAGGAAAGACCGCTGCTGG - Intergenic
1087417213 11:97872067-97872089 TGTCCTAGGAAGACACCAGCTGG - Intergenic
1090805021 11:130197545-130197567 TGCCCTGCAGAGAGGCCAGCTGG - Intronic
1090917314 11:131176997-131177019 GGACCTGGGCAGACACCAGCAGG + Intergenic
1091039339 11:132262160-132262182 TGCCCTGGAGAGACTCCTGGGGG - Intronic
1091131498 11:133150725-133150747 TCCCCAGGAAAGAAACCTGCAGG + Intronic
1091705414 12:2690138-2690160 ACCCCTGGAAAGGCAGCAGCAGG + Intronic
1095238438 12:39827871-39827893 TTTCCTGAAAAGACACCAGGTGG - Intronic
1096845082 12:54402024-54402046 TGCCCAGGTCACACACCAGCAGG + Exonic
1097756735 12:63415609-63415631 CACCATGGAAAGAAACCAGCTGG + Intergenic
1098060249 12:66554054-66554076 TGACCTAGTAAGATACCAGCTGG + Intronic
1099100970 12:78439792-78439814 TGACCCAGTAAGACACCAGCTGG - Intergenic
1099963743 12:89422547-89422569 TGCCTTGGAAAGACTACAGGTGG + Intronic
1100773787 12:97952574-97952596 TGCCATGGTAAGAAGCCAGCAGG - Intergenic
1101607410 12:106258180-106258202 TGACCTAGTAAGACACCAGCTGG + Intronic
1101821064 12:108184556-108184578 TGCTCTGGGAAGAAACCTGCAGG + Intronic
1102357200 12:112248319-112248341 TGCCATGGAGAGACAGCTGCAGG - Exonic
1102489066 12:113277913-113277935 TGCCCTGGAGAGGCAGCTGCTGG - Intronic
1105513557 13:21071672-21071694 AGGCCTGGAAAGGCACAAGCAGG - Intergenic
1106405091 13:29466263-29466285 TGCCCTGGCTAGACCTCAGCTGG - Intronic
1107210796 13:37852126-37852148 TGACCTGGGGAGACATCAGCTGG + Intronic
1107291560 13:38860159-38860181 TGCCATGCAAGGAAACCAGCTGG + Intronic
1108879109 13:55087317-55087339 TGACCTGGTGAGATACCAGCTGG - Intergenic
1113779517 13:112968379-112968401 GGCCCTGCATAGACACGAGCTGG + Intronic
1115918290 14:38342347-38342369 TGACCTAGGGAGACACCAGCTGG + Intergenic
1116057799 14:39885529-39885551 TGACCTGCTGAGACACCAGCTGG + Intergenic
1116085779 14:40236328-40236350 TGACCTAGGGAGACACCAGCGGG - Intergenic
1116275678 14:42828126-42828148 TGACCTAGTGAGACACCAGCTGG - Intergenic
1117384331 14:55195507-55195529 TGACCTAGAGTGACACCAGCTGG - Intergenic
1117418282 14:55518578-55518600 TGACCTAGAGAGACACCAGCTGG + Intergenic
1118908988 14:70045836-70045858 TGCCCTGGAGAGGCAGCATCAGG - Exonic
1123035438 14:105469989-105470011 TGCCCTGGGAAGGCCCCACCTGG - Exonic
1124142730 15:27091687-27091709 TTCCCTGGAAAGACATATGCAGG - Intronic
1126572248 15:50164601-50164623 TGACCTGGTGAGACACCAGCTGG - Intronic
1128706641 15:69841761-69841783 TTCCCTGGAAACACAACAGGGGG - Intergenic
1129474872 15:75778245-75778267 TGCCCTGGCAAGGCAGCAGGTGG + Intergenic
1129882987 15:79019216-79019238 TGCCCTGTGGGGACACCAGCAGG - Intronic
1131248752 15:90817586-90817608 TGCCATGGAGGGCCACCAGCAGG - Intergenic
1131507676 15:93031514-93031536 TGCCTGGGGAAGACACCAGCAGG - Intergenic
1131886965 15:96926462-96926484 TGCCTTGGCAAGACACATGCAGG + Intergenic
1132326361 15:100973538-100973560 TGCCCTGGAAGGGCTCCAGGTGG + Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1133166530 16:3951576-3951598 TGCCCTGGAAGGAACCCAGATGG - Intergenic
1134142792 16:11736360-11736382 TGCCCTAGAAAGGCAACATCTGG + Intronic
1134401165 16:13911151-13911173 TGACCTACAAAGACACAAGCTGG + Intergenic
1136271481 16:29151450-29151472 AGCCATGGAAACTCACCAGCTGG - Intergenic
1138504523 16:57471374-57471396 TGCACTGGAAACACTCCAGCAGG - Exonic
1140567025 16:76055655-76055677 TGACCTAGTGAGACACCAGCCGG - Intergenic
1140903155 16:79388985-79389007 TGCCCTGGAAACACATCATAAGG - Intergenic
1141353591 16:83322224-83322246 TGCTCCAGAGAGACACCAGCCGG - Intronic
1141689989 16:85591242-85591264 GGCCCTGGAAATAAACCAGGAGG - Intergenic
1141690753 16:85594948-85594970 AGCCTTGGAAAGAAACCAGGGGG + Intergenic
1142390741 16:89798124-89798146 TGCCCGGAGAAGACACCAGAGGG + Intronic
1142750281 17:1983373-1983395 TGTCCAGTAATGACACCAGCGGG + Intronic
1143221342 17:5264647-5264669 TGCCCAGGAAAGACCCGAGAAGG - Intergenic
1145052974 17:19678600-19678622 TGCCCTGCAAAAACACCAATGGG - Exonic
1146658263 17:34648063-34648085 TTCCATGGCAAGACACCACCTGG + Intergenic
1148135031 17:45286727-45286749 TGCCCAGGAAGGACTCCAGAGGG + Exonic
1149234822 17:54577807-54577829 TGACCTACCAAGACACCAGCTGG + Intergenic
1150138173 17:62707132-62707154 TGCAGGGGAAAGAAACCAGCCGG - Intronic
1150192668 17:63259326-63259348 TGACCTAGTGAGACACCAGCTGG - Intronic
1150809672 17:68346755-68346777 GGCCCTGCAAAGGCACCAGGAGG - Intronic
1150870936 17:68910582-68910604 AGACCTCGAGAGACACCAGCTGG + Intronic
1152446331 17:80346741-80346763 TGCACTGGAAGGACACCAGGTGG - Exonic
1153429394 18:4999444-4999466 TGACCTAGGGAGACACCAGCTGG + Intergenic
1154085863 18:11305165-11305187 TGACCTAGAAAGACACCAGTGGG - Intergenic
1155156803 18:23164367-23164389 GGCCCTGGGAGGACACCATCAGG - Intronic
1156924504 18:42559292-42559314 AGCCCTGGACAAACCCCAGCAGG - Intergenic
1157576940 18:48749933-48749955 TCCCCTGGAAACACTCCACCAGG + Intronic
1158949128 18:62475520-62475542 TGACCTAGTGAGACACCAGCTGG - Intergenic
1162321568 19:9973806-9973828 TGCCCTGGAGAGACAGCAAGGGG + Exonic
1165739783 19:38198270-38198292 TGCCCAGGAAAACCTCCAGCAGG - Intronic
1166253559 19:41586960-41586982 TTCCCTGGAAAGACAGGAGTAGG + Intronic
1167612625 19:50514723-50514745 TGCCATGGAAACACTGCAGCGGG - Intergenic
925269357 2:2591338-2591360 TGTTCTAGAAAAACACCAGCTGG + Intergenic
925506402 2:4569592-4569614 TGACCTAGTCAGACACCAGCTGG - Intergenic
926222669 2:10946480-10946502 TGCCCAGCCAAGAGACCAGCAGG - Intergenic
926518796 2:13883716-13883738 TGACCTGGTGAGACACCAGCTGG + Intergenic
926591652 2:14746018-14746040 TGCCCTGAAAATACCTCAGCAGG - Intergenic
927570355 2:24153698-24153720 TGACCTAGGGAGACACCAGCTGG - Intronic
928238063 2:29562498-29562520 GGCCCTGGGCAGACACCATCTGG - Intronic
928834818 2:35530763-35530785 TGACCTACTAAGACACCAGCTGG - Intergenic
932751489 2:74374280-74374302 TGCCCTGGCAACCCAGCAGCAGG + Intronic
932894435 2:75625408-75625430 TGTCCTGGAATGAGGCCAGCAGG + Intergenic
935378287 2:102422507-102422529 TGCCCTGGGAATGCTCCAGCTGG + Intronic
935729880 2:106056481-106056503 TGCCCATGAAAGACTTCAGCTGG - Intergenic
936082313 2:109440898-109440920 TGCCCAGAATACACACCAGCTGG + Intronic
936641501 2:114317048-114317070 TGACCTAGCAAAACACCAGCTGG - Intergenic
936699886 2:114998783-114998805 TGCATGGGAAGGACACCAGCAGG + Intronic
936983884 2:118289896-118289918 TGCCCCGGAAAGACACTGGTTGG - Intergenic
937672438 2:124552480-124552502 AGCCCAGGAATGAGACCAGCTGG - Intronic
938069206 2:128299708-128299730 CTGCCTGGAAAGACCCCAGCTGG + Intronic
938580802 2:132645082-132645104 AGCCCTGGGCAGACACGAGCAGG - Exonic
940404866 2:153289224-153289246 TACCCTGGAGAGACAGCAGAGGG + Intergenic
940653175 2:156457595-156457617 TTCCCTGAAAAGACACAGGCAGG - Intronic
940849754 2:158676861-158676883 TACCCTGGTAAGACGCCAGTTGG + Exonic
941047599 2:160694448-160694470 TGACCTAGAAAGACAACAGATGG - Intergenic
941932490 2:170956024-170956046 TGCTCAGGAAAGAAATCAGCTGG - Intronic
942001553 2:171652961-171652983 TGACCTGGTGAGACACCAGCTGG - Intergenic
942972337 2:181971566-181971588 TGACCTAGTGAGACACCAGCTGG - Intronic
943173959 2:184444361-184444383 TCAACTGGAAAAACACCAGCTGG + Intergenic
943845030 2:192634775-192634797 TGACCTAGAGAGACACCAGCTGG + Intergenic
943913046 2:193592740-193592762 TGACCTAGGGAGACACCAGCTGG + Intergenic
943933529 2:193885610-193885632 TGACCTAGGGAGACACCAGCTGG + Intergenic
944133337 2:196370524-196370546 TGACCTAGTGAGACACCAGCTGG - Intronic
944232272 2:197408404-197408426 ACCCCTGGAAAGACACCAATTGG - Exonic
945471166 2:210229218-210229240 TGCCCATGAAAGACTTCAGCTGG - Intergenic
947820160 2:233063728-233063750 TGCAGTGGGAAGACTCCAGCAGG + Intronic
948722888 2:239912502-239912524 TGCCCAGGAAAGACCCCAGAAGG - Intronic
948757761 2:240169176-240169198 TGCCCAGGCAGGTCACCAGCGGG - Intergenic
948874080 2:240818201-240818223 TGCCCGGGGAGGACACCTGCAGG + Intronic
1168900000 20:1355258-1355280 TGACCTAGTGAGACACCAGCTGG - Intronic
1170159744 20:13299101-13299123 TCCGCTGGAAGGACGCCAGCGGG + Exonic
1170668309 20:18406195-18406217 TGACCTAGGGAGACACCAGCTGG + Intronic
1172098550 20:32472640-32472662 TGCTCTGGACAGACACCAACAGG + Intronic
1173736243 20:45363510-45363532 TGCCCTGCAGGGACACGAGCCGG - Exonic
1173761097 20:45561345-45561367 TGCCTGGGAAAAACACCATCTGG + Intronic
1174215445 20:48912638-48912660 TGCCCTCGGAGGTCACCAGCTGG + Intergenic
1174942394 20:54943806-54943828 TGCCCTTGAAAGAGACCATTAGG + Intergenic
1175673466 20:60926789-60926811 TGCCCGTGTAAGACAACAGCGGG - Intergenic
1175852693 20:62102303-62102325 TCCCCTACAAAGACACAAGCAGG + Intergenic
1176240901 20:64075411-64075433 TGCCCTGGAGAGAGGTCAGCCGG - Intronic
1178361951 21:31956026-31956048 TGCCCTGAATATACACCAGCAGG - Intronic
1178815761 21:35927936-35927958 TGCCCAGAAAAGAGACCATCTGG + Intronic
1179625590 21:42647483-42647505 TTCACTGGCAAGACACAAGCAGG + Intergenic
1179710005 21:43207941-43207963 TTCCCTGGACAGACACCATCAGG - Intergenic
1183343335 22:37294119-37294141 TGCTCCAGAAAGACACCAGCCGG + Intronic
1184975520 22:48058787-48058809 TGCCCAGCAAAAGCACCAGCAGG + Intergenic
949191015 3:1249074-1249096 TGCCCTGGACAGATATCAGACGG + Intronic
951172212 3:19555239-19555261 TGACCTAGAGAAACACCAGCTGG - Intergenic
951437060 3:22676887-22676909 TGGCCTAGTGAGACACCAGCTGG - Intergenic
954100931 3:48372130-48372152 TCCCAGGGAAAGCCACCAGCTGG + Intergenic
954404851 3:50339963-50339985 TCCCCTGGGTAGACACCAGCTGG - Intronic
955158932 3:56445767-56445789 AGCCCTGCAAAGAGAACAGCAGG - Intronic
957288709 3:78249450-78249472 CTCCCTGGAAAAACTCCAGCCGG + Intergenic
960471905 3:118076073-118076095 TGACCTAGTGAGACACCAGCTGG - Intergenic
962015082 3:131431250-131431272 TGCCCTAGTGAGACACCAGATGG + Intergenic
962378072 3:134875288-134875310 AGCCCTGGTGAGACACCAGGTGG - Intronic
965322340 3:167265583-167265605 TGACCTAGAGAGACACCACCTGG - Intronic
965867098 3:173217298-173217320 TGACCTAGTGAGACACCAGCTGG - Intergenic
966183149 3:177204837-177204859 TGTCATAGAAAGACACCAGGAGG + Intergenic
966998417 3:185308301-185308323 TACCATGGAAAGACACCAGAGGG - Intronic
968096119 3:195932037-195932059 TGACCTAGTGAGACACCAGCGGG + Intergenic
969606711 4:8205576-8205598 GTCCCTGGAAAAACACGAGCTGG - Intronic
969918484 4:10513497-10513519 TGCCCTATAAATACACAAGCTGG - Exonic
970892789 4:21066897-21066919 TGACCTGGTGAGATACCAGCCGG + Intronic
972579105 4:40379467-40379489 TGACCTAGTGAGACACCAGCTGG + Intergenic
974868027 4:67603870-67603892 TGACCTAGTGAGACACCAGCTGG - Intronic
976136865 4:81947148-81947170 TGCCAATGAAAGGCACCAGCAGG + Intronic
976721988 4:88178068-88178090 TGACCTAGTGAGACACCAGCTGG + Intronic
976762844 4:88568964-88568986 TGACCTAGTGAGACACCAGCTGG - Intronic
979396662 4:120197525-120197547 TGACCTAGGGAGACACCAGCTGG + Intergenic
981996084 4:150977114-150977136 TGACCTGGTAAGACCCCAGCTGG + Intronic
982683449 4:158459641-158459663 TGACCTAGGGAGACACCAGCTGG - Intronic
983526302 4:168763617-168763639 TGCCCTGGTACCACAGCAGCAGG + Intronic
985384816 4:189434360-189434382 TGTCCTAGAAAGACAGCAACTGG - Intergenic
986074233 5:4318167-4318189 TGACATGGAAAGACACAAGGAGG + Intergenic
986085165 5:4437642-4437664 TGACCTAGTAAGACACCAGTTGG - Intergenic
986318607 5:6609317-6609339 TGCCTTGGAAAGGAACCAGCAGG + Intronic
986456824 5:7928002-7928024 TGCCCTGGAAAGAGATCTGAAGG - Intergenic
987616045 5:20276182-20276204 TGACCTAGTGAGACACCAGCTGG + Intronic
990529604 5:56660320-56660342 ATCCCTGCAAAGACACCAACCGG + Intergenic
990703287 5:58498517-58498539 TCTCCTGGGAAGACACCAGGGGG + Intergenic
990922053 5:60978805-60978827 TGACCTAGTGAGACACCAGCTGG + Intronic
991501812 5:67284321-67284343 GTCCCTGGAAAGGCACCAGAAGG + Intergenic
992397639 5:76382321-76382343 GGCCCTGGAGAGACACAAGGGGG - Intergenic
993205714 5:84875773-84875795 TGACCTAGCAAGACACCAGCTGG + Intergenic
993226942 5:85179266-85179288 TGCTCAGGAAATCCACCAGCCGG - Intergenic
995265227 5:110152146-110152168 TGACCTAGAGAGACACCAGCAGG + Intergenic
995319555 5:110817792-110817814 TTCCCTGGAAAGACAAGTGCAGG + Intergenic
995524953 5:113043487-113043509 TGCCCAGGATAAACACCAGCTGG + Intronic
996533770 5:124554494-124554516 TGCAGTTGTAAGACACCAGCTGG - Intergenic
997073350 5:130642909-130642931 TGACCTACAGAGACACCAGCCGG - Intergenic
997280518 5:132641146-132641168 TGCCCTGCTAAGACATCTGCAGG + Intronic
997978473 5:138454187-138454209 CCCCCTGGAAACACAGCAGCCGG + Intergenic
998203533 5:140143786-140143808 TCCCCTGCAACCACACCAGCAGG - Intergenic
998215880 5:140238408-140238430 TTCCCTGGAAGGACAGAAGCTGG + Intronic
998312900 5:141152433-141152455 TGCCCTGGAAAGGGACCCTCGGG - Exonic
998320572 5:141225687-141225709 TGCCCTGGAAAGGGACCCTCGGG - Exonic
998349172 5:141489849-141489871 AGCCCAGGCAAGACATCAGCTGG + Exonic
999175395 5:149628473-149628495 TGCTCTGGGCAGACACCAGAGGG + Intronic
1001052453 5:168424010-168424032 CGCCCAGGAAAGATACCGGCTGG + Exonic
1001795742 5:174501152-174501174 GGCCCTGGTAAGACTTCAGCAGG - Intergenic
1002169197 5:177366060-177366082 TTCCCTGGAAAGATAGCAGGTGG - Intronic
1003943695 6:11053548-11053570 TGTCCTGGAAAGAGTCCAACAGG - Intergenic
1005157141 6:22819728-22819750 TGACCTAGCAAGACACAAGCTGG - Intergenic
1005879237 6:30042327-30042349 AGCCCTGGAAGGACAAGAGCTGG - Intergenic
1006018715 6:31103867-31103889 TGACCTAGGTAGACACCAGCCGG - Intergenic
1006512471 6:34529092-34529114 TCCCCAGGAAAGATACCAGCAGG + Intronic
1007661582 6:43490055-43490077 TGCCCTGGGGTGCCACCAGCAGG + Intronic
1007753496 6:44083997-44084019 TTCCCTGGAAAGACCCCAGCAGG - Intergenic
1007851344 6:44805376-44805398 TGCTCTGGAGATACACCAGAAGG - Intergenic
1009574137 6:65430545-65430567 TGACATACAAAGACACCAGCTGG + Intronic
1010324999 6:74554378-74554400 TGACCTAGTAAGACACCAGCTGG + Intergenic
1010653843 6:78488367-78488389 TCCCCTGGACAGATACCAACGGG - Intergenic
1010775324 6:79878603-79878625 TGACCTAGAGAGACACCAGCTGG + Intergenic
1013241594 6:108251500-108251522 TGCCCTTGAAGGACACAACCAGG - Intronic
1014196375 6:118564298-118564320 TTCTGTGTAAAGACACCAGCTGG + Intronic
1014794643 6:125710611-125710633 TGACCTAGTGAGACACCAGCAGG + Intergenic
1016038745 6:139410136-139410158 TGCCCTGGAAAGACATTGACAGG + Intergenic
1016054797 6:139567213-139567235 TGACCTAGTGAGACACCAGCTGG - Intergenic
1016706331 6:147112587-147112609 TTCCCTGGAAAGAAAACAACAGG + Intergenic
1017393442 6:153967829-153967851 TGCCTTGAAAACACACCAGCAGG + Intergenic
1019692373 7:2423421-2423443 GGCCATGGAGAGACAGCAGCGGG + Intronic
1019692378 7:2423444-2423466 GGCCGTGGAGAGACAGCAGCAGG + Intronic
1020015710 7:4830304-4830326 GGCCCTAGAGAGACACCTGCTGG - Intronic
1022554505 7:31279313-31279335 TACCCAGGGAAAACACCAGCTGG + Intergenic
1023892568 7:44403791-44403813 TGCCCTGTAAACACCCCAGTAGG + Intronic
1023964106 7:44953047-44953069 AGACCTGTAAAGTCACCAGCGGG - Intergenic
1026321996 7:69276361-69276383 TGCCCTGGAGAGAGGCCATCAGG - Intergenic
1026947260 7:74324667-74324689 TGCCCTGCAAAGGCAGCAGCCGG - Intronic
1027523994 7:79244752-79244774 TGACCTAGGAAAACACCAGCTGG + Intronic
1028354385 7:89888053-89888075 TGACCTAGGGAGACACCAGCTGG - Intergenic
1031098414 7:117448498-117448520 TGACCTAGGAAGACACCAGCTGG + Intergenic
1031306186 7:120130623-120130645 TGACCTAGTGAGACACCAGCTGG + Intergenic
1031862235 7:126993983-126994005 TGGCCTAGAAAGACACCAGATGG + Intronic
1032523023 7:132560757-132560779 TGCCCAGGCAAGACACCTGCAGG + Intronic
1035530403 8:346302-346324 TGCCCTGGAATGACCCACGCTGG - Intergenic
1037254776 8:16941443-16941465 TGACCTAGGAAGACACCAGCTGG + Intergenic
1039612494 8:38930807-38930829 TGCCCTAGAGACACAGCAGCTGG - Intronic
1039612930 8:38933273-38933295 TTCCATGGAAAGACACGAGAGGG - Intronic
1039635359 8:39158630-39158652 TGCCTTGGAAACACAGCAGTAGG - Intronic
1041936106 8:63333309-63333331 TCCCCTGGTAAGTTACCAGCAGG - Intergenic
1042367174 8:67950931-67950953 TGCTCTGGAAAGACATCATCTGG + Intergenic
1043600262 8:81928918-81928940 TGACCTAGGGAGACACCAGCTGG + Intergenic
1046384164 8:113487019-113487041 TGACCTAGGAAGACACCAGCTGG - Intergenic
1046861917 8:119102562-119102584 AGGCTTGGAAAGTCACCAGCAGG - Intronic
1046902889 8:119541740-119541762 GGCCATGGAAACACCCCAGCAGG - Intergenic
1047315183 8:123726558-123726580 TCCCCTGGAAAGACACAGGCTGG - Intronic
1047933560 8:129753140-129753162 TGACCTAAAGAGACACCAGCTGG + Intronic
1048270883 8:133027075-133027097 GGCCATGGAACCACACCAGCCGG - Intronic
1048490903 8:134892863-134892885 TGCCCAGGAAAGACCCAAGTGGG - Intergenic
1049386247 8:142344469-142344491 GGCCCTGGAAAGGCACCAAAAGG + Exonic
1049608179 8:143539378-143539400 TACCCTGGAAGGGCATCAGCTGG + Intronic
1049679932 8:143913603-143913625 CCCCTTGGAAAGACAACAGCTGG + Intergenic
1049827840 8:144681399-144681421 TGTCCTGTAAAGACACCACAAGG - Intergenic
1050287091 9:4114765-4114787 AGGCCTGGAAAGAGAGCAGCTGG + Intronic
1050339576 9:4622260-4622282 TGCCCTGGAAATTCCACAGCTGG + Intronic
1051306654 9:15717480-15717502 TGACCTAGTGAGACACCAGCGGG + Intronic
1055826948 9:80338807-80338829 TGACTTAGTAAGACACCAGCTGG + Intergenic
1055886545 9:81069905-81069927 TGACCTAGGGAGACACCAGCTGG - Intergenic
1056898594 9:90576783-90576805 TGCCATGGAAAGAGAACAGCAGG - Intergenic
1057482339 9:95455259-95455281 AGCCCTGGAAAGACTGCAGAAGG + Intronic
1060078890 9:120622311-120622333 TCCCCTGGAAAGACAATGGCTGG + Intronic
1061616981 9:131786823-131786845 TGCTCTGGAATATCACCAGCAGG + Intergenic
1062128693 9:134880863-134880885 TGCCCAGGAAAGAGAGCAGCAGG - Exonic
1062419736 9:136474438-136474460 TGGCCTCGAAAGAGCCCAGCAGG - Exonic
1062457958 9:136648886-136648908 TGCTCTGGCCAGACGCCAGCCGG - Intergenic
1185810421 X:3103818-3103840 TGGCCTGGAAAGGTACCAGCTGG + Exonic
1186340526 X:8640832-8640854 TACTCTGGAAAGAAACCAGTGGG + Intronic
1187333691 X:18363557-18363579 AGCCCAGGAAAGACACAGGCTGG - Intergenic
1187579386 X:20592200-20592222 CGACCTGGGGAGACACCAGCTGG - Intergenic
1187693763 X:21897873-21897895 TCACCTCGAAAGTCACCAGCGGG - Intergenic
1188161966 X:26815110-26815132 TGACCTAGTGAGACACCAGCTGG - Intergenic
1188578917 X:31686813-31686835 TGACCTAGGGAGACACCAGCTGG + Intronic
1188625241 X:32276374-32276396 TGACCTAGGGAGACACCAGCTGG + Intronic
1188924685 X:36024442-36024464 TGACCTAATAAGACACCAGCTGG - Intergenic
1191197092 X:57736335-57736357 TGACCTAGGTAGACACCAGCTGG + Intergenic
1191834184 X:65446346-65446368 TGACCCAGTAAGACACCAGCGGG - Intronic
1192046077 X:67675297-67675319 CGACCTAGTAAGACACCAGCTGG - Intronic
1192503029 X:71665629-71665651 AGCCCTGGGAAGAAACCAGCAGG - Intergenic
1192503785 X:71668941-71668963 AGCCCTGGGAAGAAACCTGCAGG + Intergenic
1192510233 X:71717004-71717026 AGCCCTGGGAAGAAACCAGCAGG - Exonic
1192516464 X:71764549-71764571 AGCCCTGGGAAGAAACCAGCAGG + Exonic
1192522547 X:71814993-71815015 AGCCCTGGGAAGAAACCAGCAGG + Intergenic
1192529359 X:71872145-71872167 AGCCCTGGGAAGAAATCAGCAGG - Intergenic
1192695436 X:73410293-73410315 TGACCTGCTGAGACACCAGCTGG + Intergenic
1194052356 X:89086859-89086881 TGTCCTGCAAAGACACCATCAGG + Intergenic
1194327749 X:92541044-92541066 TGACCTAGGAAGACACCAGCTGG - Intronic
1194329157 X:92559950-92559972 TGACCTAGGCAGACACCAGCTGG + Intronic
1194388968 X:93292768-93292790 TGACCTAGGGAGACACCAGCTGG + Intergenic
1195061111 X:101195678-101195700 TGCTCTGGAAAGACTCAAGAAGG - Intergenic
1195199278 X:102532436-102532458 TGACCTAGGGAGACACCAGCTGG + Intergenic
1196096836 X:111809152-111809174 TGACCTAGTGAGACACCAGCAGG - Intronic
1197586868 X:128359058-128359080 TGCCCTGGAGAGACATTAGAAGG + Intergenic
1199325133 X:146490242-146490264 TGACCTAGGGAGACACCAGCTGG + Intergenic
1199694033 X:150330888-150330910 TGCCCTGCAAAGAGACCTCCAGG + Intergenic
1200637858 Y:5679139-5679161 TGACCTAGGCAGACACCAGCTGG + Intronic
1201916270 Y:19184673-19184695 TGCACAGGAAAGACACCACACGG - Intergenic