ID: 903222291

View in Genome Browser
Species Human (GRCh38)
Location 1:21875634-21875656
Sequence CTCAGCGGGCTGCTGGGCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903222276_903222291 21 Left 903222276 1:21875590-21875612 CCAAGCCCATGCTGGTCCTCCTG 0: 1
1: 0
2: 1
3: 35
4: 345
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222284_903222291 -4 Left 903222284 1:21875615-21875637 CCGGCTCCAGACACCTGCTCTCA 0: 1
1: 0
2: 1
3: 49
4: 383
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222287_903222291 -10 Left 903222287 1:21875621-21875643 CCAGACACCTGCTCTCAGCGGGC 0: 1
1: 0
2: 0
3: 7
4: 159
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222272_903222291 27 Left 903222272 1:21875584-21875606 CCCTCCCCAAGCCCATGCTGGTC 0: 1
1: 2
2: 1
3: 37
4: 358
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222277_903222291 16 Left 903222277 1:21875595-21875617 CCCATGCTGGTCCTCCTGCCCCG 0: 1
1: 0
2: 2
3: 26
4: 270
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222271_903222291 28 Left 903222271 1:21875583-21875605 CCCCTCCCCAAGCCCATGCTGGT 0: 1
1: 1
2: 5
3: 43
4: 417
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222280_903222291 5 Left 903222280 1:21875606-21875628 CCTCCTGCCCCGGCTCCAGACAC 0: 1
1: 1
2: 2
3: 50
4: 542
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222283_903222291 -3 Left 903222283 1:21875614-21875636 CCCGGCTCCAGACACCTGCTCTC 0: 1
1: 0
2: 1
3: 64
4: 504
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222274_903222291 23 Left 903222274 1:21875588-21875610 CCCCAAGCCCATGCTGGTCCTCC 0: 1
1: 0
2: 2
3: 27
4: 302
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222282_903222291 -2 Left 903222282 1:21875613-21875635 CCCCGGCTCCAGACACCTGCTCT 0: 1
1: 0
2: 2
3: 39
4: 322
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222273_903222291 26 Left 903222273 1:21875585-21875607 CCTCCCCAAGCCCATGCTGGTCC 0: 1
1: 1
2: 2
3: 43
4: 305
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222275_903222291 22 Left 903222275 1:21875589-21875611 CCCAAGCCCATGCTGGTCCTCCT 0: 1
1: 0
2: 3
3: 41
4: 326
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222281_903222291 2 Left 903222281 1:21875609-21875631 CCTGCCCCGGCTCCAGACACCTG 0: 1
1: 2
2: 3
3: 47
4: 409
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162
903222278_903222291 15 Left 903222278 1:21875596-21875618 CCATGCTGGTCCTCCTGCCCCGG 0: 1
1: 1
2: 3
3: 42
4: 427
Right 903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG 0: 1
1: 0
2: 0
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903222291 Original CRISPR CTCAGCGGGCTGCTGGGCGT AGG Exonic
901138668 1:7013894-7013916 CTCAGCTGGCTGCTTGTCGTTGG - Intronic
901840517 1:11951162-11951184 CTCACTGGGCTCCTGGCCGTTGG + Intronic
902481740 1:16715670-16715692 TTCACCTGGCTGCAGGGCGTGGG - Intergenic
902859829 1:19237184-19237206 CTCAGTGGGCTACCGGGCTTTGG - Exonic
903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG + Exonic
903750173 1:25616679-25616701 CTCAGCCGGCTGCGGCGCGGCGG + Intergenic
905858406 1:41330159-41330181 CTCAGCAGGCTCCTGGGCAGAGG - Intergenic
907403143 1:54238151-54238173 CTCAGAGGGCTGCTGGATGTAGG + Intronic
912514020 1:110206946-110206968 CTCTGCAGGCTGCTTGGGGTTGG + Intergenic
915277852 1:154801885-154801907 CTCAGCAGTCTGATGGGAGTGGG + Intronic
916174161 1:162023845-162023867 CGGCGCGGGCTGCTGGGCGAGGG + Exonic
923496606 1:234531070-234531092 CTCAGCGGGCTGCTGTGGTGAGG + Intergenic
923623334 1:235595098-235595120 CCCCGAGGGCTGCTGGGCCTTGG - Intronic
924198926 1:241640085-241640107 TCCATTGGGCTGCTGGGCGTCGG - Exonic
1063200874 10:3784811-3784833 CTCTGCGGTCCGCTGGGCCTGGG - Intronic
1063999258 10:11649701-11649723 CTCACAGGGCTGTTGGGCCTGGG + Intergenic
1065189263 10:23195282-23195304 CGCAGCGGCCTGGTGGGCGAAGG + Intergenic
1073461613 10:103668808-103668830 CTGGGCTGGCTGTTGGGCGTGGG + Intronic
1076248508 10:128966380-128966402 CTGAGGGGGCTGCTGGTGGTTGG + Intergenic
1076577671 10:131480974-131480996 ATCAGCGAGCTGCTGGCCCTGGG - Intergenic
1076694272 10:132239637-132239659 CACTGCGGGCGGCTGGGCCTGGG - Intronic
1076884781 10:133257374-133257396 CTCAGCGGGAAGGTGGGTGTGGG - Intergenic
1077538281 11:3134776-3134798 CTCAGAGGTCTGCTGGGACTTGG + Intronic
1081569096 11:44278593-44278615 CTCAGTGGGCAGCTGGAGGTGGG - Intronic
1081675005 11:44963510-44963532 CACAGCAGGCTGCTGGGGGAAGG + Intergenic
1082028862 11:47590759-47590781 CCCAGCGGCCTGCTGGGCCCTGG - Exonic
1082653196 11:55820050-55820072 CTCTGCGTGCTGCTGGTTGTGGG + Exonic
1083765177 11:64838215-64838237 CCCAGGGGGCTCCTGGGCCTTGG - Intronic
1083959604 11:66007281-66007303 CTCAGCAGGCTGCCGGGGGCAGG - Intergenic
1086590477 11:88509154-88509176 CTCAGCGTGCTGATGGGCGACGG + Exonic
1088411391 11:109538801-109538823 GTCACGGTGCTGCTGGGCGTGGG - Intergenic
1089346990 11:117797004-117797026 CTGCGCGGGCGGCTGGGCGGCGG - Intronic
1090879060 11:130817206-130817228 CCCAGCAGGCTGATGGGAGTGGG + Intergenic
1096220134 12:49823966-49823988 CGCCGAGGGCTGCTGGGCGGTGG + Intronic
1100444749 12:94650325-94650347 CGCAGCGGGCTGGGGGGCGGCGG - Intronic
1100565649 12:95790963-95790985 ACCAGCGGGCAGCCGGGCGTCGG - Intronic
1100699996 12:97137327-97137349 TTCAGCAGGCTGCTGGGCTCAGG - Intergenic
1103451361 12:121031583-121031605 CTCAGGGGGTGGCTGGGAGTTGG + Exonic
1104043473 12:125145544-125145566 CTCAGAGGCCTGCTGGCCGTGGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1105961726 13:25347471-25347493 CTCCACAGGCTGCTGGGCCTCGG + Intronic
1107410019 13:40150068-40150090 CTCCGTGAGCTGCTGGGAGTGGG - Intergenic
1113483343 13:110637510-110637532 AACAGCGTGCTGCTGGGCCTTGG - Intronic
1113517495 13:110914776-110914798 CTCAGAGGCCAGGTGGGCGTGGG + Exonic
1113759245 13:112836034-112836056 CACAGAGGGCTGCTGGGTGAGGG - Intronic
1113850527 13:113415062-113415084 CCCAGGGGGTTGCTGGGCGCTGG - Intergenic
1113926909 13:113946807-113946829 CTCAGAGAGCTGCCGGGCGCAGG - Intergenic
1119219383 14:72893667-72893689 CTTCGGGGGCTGCTGGGCGGGGG - Intronic
1122272813 14:100575914-100575936 CTCTGGGGGCTGCTGGGCCCTGG - Intronic
1122689006 14:103522761-103522783 CTCACCGGGCGGCCGGGCGGGGG + Exonic
1122863302 14:104592069-104592091 CTCAGGTGGATGCTGGGCGTGGG + Intronic
1132653213 16:1030821-1030843 CTCAGGGGGCTCCGGGGCGTGGG + Intergenic
1133055089 16:3141805-3141827 CCCAGGGGGCTGCTGGACTTTGG + Exonic
1133339319 16:5026627-5026649 CACAGCTGGATGCTGGGCATGGG + Intronic
1135435041 16:22420980-22421002 CTCAGCTGGTGGCTGGGCTTGGG + Intronic
1136412424 16:30085128-30085150 CTCAGACGGAGGCTGGGCGTGGG + Exonic
1137026848 16:35485764-35485786 CTCAGCTGGGGGCTGGGCCTTGG + Intergenic
1139434076 16:66926150-66926172 CTGAGAGGGCTGTTGGGGGTGGG + Intergenic
1140201832 16:72901199-72901221 CTCAGCGGGCTGCAGAGCAAGGG - Intronic
1142044226 16:87914755-87914777 CTCAGCTGGCGGCTGGGCTTGGG + Intronic
1142852607 17:2711524-2711546 GCCAGCGGGCCGCTGGGCGGGGG - Intronic
1143451979 17:7042070-7042092 CTCCCCGGGCTGGTGGGCGTCGG - Exonic
1143579562 17:7817710-7817732 GTGAGGGTGCTGCTGGGCGTGGG + Intronic
1145796994 17:27661259-27661281 CTCAGAGGGCTGCTGGGAAGGGG - Intergenic
1146274544 17:31508448-31508470 GTCAGCAGGCTTCTGGGAGTGGG + Intronic
1146278891 17:31532310-31532332 CACAGAGGGCTGCTGGCCGGTGG - Exonic
1146842111 17:36163462-36163484 CTCAGAGGGCTGCTGGGAAGGGG + Intergenic
1146854419 17:36251421-36251443 CTCAGAGGGCTGCTGGGAAGGGG + Intronic
1146870322 17:36375313-36375335 CTCAGAGGGCTGCTGGGAAGGGG + Intronic
1146877679 17:36426394-36426416 CTCAGAGGGCTGCTGGGAAGGGG + Intronic
1147073203 17:37975937-37975959 CTCAGAGGGCTGCTGGGAAGGGG + Intergenic
1147084725 17:38055475-38055497 CTCAGAGGGCTGCTGGGAAGGGG + Intronic
1147100672 17:38179441-38179463 CTCAGAGGGCTGCTGGGAAGGGG + Intergenic
1147156724 17:38547826-38547848 ATCAGCTGGCGGCGGGGCGTGGG + Intronic
1147457364 17:40546140-40546162 GTCAGCAGGCTGCAGGGCATAGG + Intergenic
1147887747 17:43696103-43696125 CCCAGCTGGGTGCTGGGCATTGG - Intergenic
1150083609 17:62262488-62262510 CTCAGAGGGCTGCTGGGAAGGGG + Intergenic
1150614081 17:66755452-66755474 TTCAGCGGTCTCCTGGGCTTTGG - Intronic
1151529366 17:74694912-74694934 CTCAGGGGGCTTCTAGGAGTTGG - Exonic
1152071179 17:78134490-78134512 CTCAACGGGCTCCTGGTGGTTGG + Exonic
1152120335 17:78414519-78414541 CTCAGTGGGCAGCTGGGCAGGGG + Intronic
1152903620 17:82958641-82958663 CTCAGGGAGCTGCAGGGCTTAGG + Intronic
1155053933 18:22169411-22169433 CTCAGCGAGCAGCTGGGCGCTGG - Intergenic
1158976695 18:62716447-62716469 TTCAGCGGGCTCCCGGGCGGCGG - Exonic
1160256312 18:77250996-77251018 CGCAACGCGCTGCTGGGCGTGGG + Exonic
1160426797 18:78783368-78783390 CTCTGTGGCCTGCTGGACGTAGG + Intergenic
1160534278 18:79584055-79584077 CCCAGGGTGCTCCTGGGCGTGGG + Intergenic
1160534311 18:79584131-79584153 CCCACCGTGCTCCTGGGCGTGGG + Intergenic
1160780564 19:876213-876235 CTCAGCCGGCAGCTGCACGTGGG - Intronic
1161232095 19:3179503-3179525 TGCGGCGGGCCGCTGGGCGTGGG - Exonic
1161441561 19:4294653-4294675 CTCTTCGTGCTGCTGGGGGTGGG - Exonic
1163753569 19:19092955-19092977 CCCAGCCGGTTGCTGGGGGTCGG - Intronic
1164741108 19:30576190-30576212 GAGAGCAGGCTGCTGGGCGTGGG + Intronic
1165831910 19:38734706-38734728 CCCACCGCGCTGCTGGGAGTTGG - Intronic
1165922659 19:39308366-39308388 CTCAGCGGGCGGCAGGGCGCCGG + Exonic
1166690724 19:44820186-44820208 CTCAGGGGGATGATGGGTGTTGG - Intronic
1202715779 1_KI270714v1_random:41582-41604 TTCACCTGGCTGCAGGGCGTGGG - Intergenic
925832809 2:7912638-7912660 CTGAGCTGCCTGCTGGGCCTGGG + Intergenic
929598486 2:43190708-43190730 CTAAGCTGGCTGCTGGGCTTGGG + Intergenic
931753558 2:65351526-65351548 CTCAGCTGGCGTCTGGGAGTTGG - Intronic
932599321 2:73112935-73112957 CTCACCGGGCCGCTGGCCGCGGG + Exonic
932611459 2:73203018-73203040 GTCTGCGGCCTGCTGGGCTTCGG + Exonic
936059025 2:109282548-109282570 CTCAGCTGACTGCAGGGCCTGGG + Intronic
937311891 2:120907888-120907910 CCCACCGGACTGCTGGGCATGGG + Intronic
947916546 2:233835898-233835920 TTCAGCTGTCTGCTGGGTGTGGG + Intronic
948182626 2:235994621-235994643 ATCATCGGGCTGCGAGGCGTTGG - Intronic
948290839 2:236823257-236823279 CTGTGCGGGGTGCTGGGTGTGGG + Intergenic
1168809455 20:694703-694725 ACCAGTGGGCTGCTGGGCATAGG + Intergenic
1169194330 20:3675088-3675110 CTCAGCAGGCTGCTGGCCCCAGG - Exonic
1172021445 20:31917197-31917219 CTGAGAGGGCTGCTGAGGGTAGG - Intronic
1172061198 20:32188570-32188592 CACAGCTGGCTGCTGGGCATGGG - Intergenic
1172712439 20:36936347-36936369 CTCACCAGGCTGCAGTGCGTTGG + Intronic
1173485572 20:43438587-43438609 CTCAGAAGGCTGCTGGGTGGGGG - Intergenic
1173816926 20:45995554-45995576 CTGAGCTGGGTGCTGGGCGCAGG - Intergenic
1175064072 20:56270396-56270418 CTCAGAGGGCTCCTGGTCGCTGG - Intergenic
1176173496 20:63707178-63707200 CTGAGCGGTCGGCTGGACGTGGG - Intronic
1176235951 20:64053610-64053632 CACAGGGGGCTGGTGGGGGTGGG + Intronic
1176385609 21:6137430-6137452 CTCGCAGGGCTGCTGGGGGTGGG + Intergenic
1179491163 21:41742405-41742427 CTCTGCAGGCTGCTAGGCCTGGG - Intronic
1179737864 21:43400822-43400844 CTCGCAGGGCTGCTGGGGGTGGG - Intergenic
1181024100 22:20117774-20117796 CTCGGCCGTCTGCTGGGCCTCGG + Intronic
1181522724 22:23458784-23458806 CCCAGAGGGCTGCCGGGCGAAGG + Intergenic
1183324482 22:37183994-37184016 CTCAGCAGCCTGCTGGGAGGTGG - Intronic
1183457285 22:37929769-37929791 CTCAGAGGCCTGCAGAGCGTTGG - Intronic
1184266243 22:43348079-43348101 CTCAAAGGGCTGAGGGGCGTGGG + Intergenic
1185384544 22:50525864-50525886 CTCTGCGGGCCGCTGAGCGCGGG + Exonic
952172315 3:30821159-30821181 CTCTGGGGACTGCTGGGTGTGGG + Intronic
952861421 3:37815879-37815901 CTCTGCGGGCAGCTGGGAGTTGG + Intronic
953139064 3:40210735-40210757 CTCAGGGGCCTACTGGGGGTAGG - Intronic
954146438 3:48636606-48636628 CTGAGTGGCCTGCTGGGGGTGGG - Exonic
954146841 3:48638763-48638785 CACTGAGGGCTGCTGGGGGTGGG - Intronic
954325590 3:49861649-49861671 CTCAGCCAGCTGCCTGGCGTAGG - Intronic
954706104 3:52481323-52481345 CTCAGTGTGCTGCTCTGCGTTGG - Intronic
957051576 3:75415962-75415984 CAGAGCGGGATGCTGGGAGTAGG + Intergenic
957206478 3:77205270-77205292 CTCAGTGGGGAGCTGGGCGGGGG + Intronic
961182450 3:124887258-124887280 CCCAGCGGGCTGCTCCGGGTAGG + Exonic
965530937 3:169769286-169769308 CCCAGCAGGCTGCTGGGGCTGGG - Intronic
966923459 3:184629509-184629531 CTCAAGGGGCTGCTGGGACTAGG - Intronic
968173466 3:196528878-196528900 CTCCGCGGGGAGCTGGGCGGTGG + Intergenic
969478116 4:7432700-7432722 CTCCAAGGGCTGCTGGGCTTCGG - Exonic
969815617 4:9685225-9685247 CTCACCTGGCTGCTGGACATAGG - Intergenic
983377316 4:166946408-166946430 CTCAGCCTGCTCCTGCGCGTTGG + Intronic
987301163 5:16599098-16599120 CTCAGGAGGCTGATGGGCGAGGG + Intronic
988737954 5:34041351-34041373 TTCAGTGGCCTGCTGGGTGTTGG + Intronic
997857188 5:137382992-137383014 CTCAGGGGGCTGCTTGGTGCTGG - Intronic
1002286202 5:178164312-178164334 CACAGCGGGCTCCCGGGCGACGG - Intergenic
1003865060 6:10355388-10355410 CTCGGCAGGCTGCTGGGCAGGGG - Intergenic
1005288760 6:24357770-24357792 CTCAGCTCGCTGCTTCGCGTCGG + Exonic
1006136985 6:31901537-31901559 CCTAGCGGGCTGCTGGGCTGGGG - Intronic
1007646405 6:43384988-43385010 CTCAGCTTGCTGCTGGGCCACGG - Intergenic
1007700467 6:43763325-43763347 CCCAGGGGGCTGCTGGGGGAAGG + Intergenic
1007776529 6:44227249-44227271 CTCAGGGGCCTGCTGGGGGCAGG - Exonic
1014055930 6:117015042-117015064 CTCAGTGGGCTCCTGTGCGCCGG + Intergenic
1016940954 6:149482521-149482543 CAGAGCGGGCTGCTGGGGGTGGG + Intronic
1018930873 6:168239539-168239561 CTCAGCGGCCTGCAGGCCGAGGG + Intergenic
1019348290 7:541264-541286 CTCAGCGGGCTCCCTGGGGTTGG - Intergenic
1019440650 7:1044641-1044663 CTCACCGGCTTGCTGGGCGGCGG - Intronic
1019588600 7:1817753-1817775 CCCAGAGGGCTGCCGGGCGGAGG - Intronic
1019711818 7:2521319-2521341 CTCAGCGGGCTGGCGGGAGGGGG + Intronic
1019910764 7:4099468-4099490 CTCAGCGGGCTCCGGGGCTGGGG + Intronic
1023096816 7:36669809-36669831 CTCAGAGAGCTCCTGGGCTTAGG + Intronic
1024223050 7:47303240-47303262 GTCAGCGGGATGCTGGGGGTCGG + Exonic
1027422803 7:78033778-78033800 CTCAGTGGGCTGCTGTGGGAAGG + Intronic
1027827562 7:83135375-83135397 CTCAGGGGGCTGCTTGGCCTTGG + Exonic
1031369396 7:120946551-120946573 CTGGGCTGGCTGCTGGGTGTTGG - Intergenic
1036481252 8:9141548-9141570 CTCAGTGGTTTGCTGGGCTTTGG + Exonic
1039451906 8:37681859-37681881 CTCGGCGGGCTGCTGGGTGCAGG + Intergenic
1042810749 8:72822963-72822985 CTCAGGGAGCTGCTGGGGTTGGG - Intronic
1047967937 8:130060723-130060745 CTCAGAGGGTTGCTGAGCCTTGG + Exonic
1049344345 8:142130455-142130477 CTCAGCGTGCTGCTGGCTGCAGG - Intergenic
1056232930 9:84565338-84565360 CTCAGGGGGCTGCTGGGAAGTGG + Intergenic
1056685693 9:88757455-88757477 CTCAGCGGGGTGCTGTCTGTTGG + Intergenic
1057869675 9:98708571-98708593 AGCGGCGGGCTGCTGGGCGGCGG + Exonic
1059343251 9:113611605-113611627 CCCAGCAGGCTGCTGGGCAGAGG + Intergenic
1060969987 9:127732381-127732403 CTCAGCCGCCTTCTGGGTGTAGG + Intronic
1061681339 9:132243870-132243892 GTCAGCAGGGTGCTGGGGGTGGG - Exonic
1062230480 9:135479510-135479532 CTCCGCGGGGTGCGGGGCGAAGG - Intronic
1062446048 9:136595421-136595443 CTCCAGGGGCTGCTGGGCGAGGG - Intergenic
1062730003 9:138103437-138103459 CTCAGAGGGCTGCTGGAGGATGG + Intronic
1190971477 X:55353213-55353235 ATCACCGGGCTGCTGGACCTAGG - Intergenic
1196055702 X:111352395-111352417 CTCAGCAGGCTTCTGGGCTAAGG + Intronic