ID: 903227804

View in Genome Browser
Species Human (GRCh38)
Location 1:21903773-21903795
Sequence CCTCCAAGGCAGAGACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 259}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903227804_903227808 -3 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227808 1:21903793-21903815 AGGCTCCTATGACATAGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 79
903227804_903227809 -2 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227809 1:21903794-21903816 GGCTCCTATGACATAGCTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 56
903227804_903227813 14 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227813 1:21903810-21903832 CTAGGGGTGGGCACCCAACCCGG 0: 1
1: 0
2: 2
3: 12
4: 136
903227804_903227807 -4 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227807 1:21903792-21903814 GAGGCTCCTATGACATAGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 89
903227804_903227814 19 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227814 1:21903815-21903837 GGTGGGCACCCAACCCGGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 97
903227804_903227817 30 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227817 1:21903826-21903848 AACCCGGTCTGGCACTGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 63
903227804_903227812 2 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227812 1:21903798-21903820 CCTATGACATAGCTAGGGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 78
903227804_903227810 1 Left 903227804 1:21903773-21903795 CCATGTGGTCTCTGCCTTGGAGG 0: 1
1: 0
2: 0
3: 33
4: 259
Right 903227810 1:21903797-21903819 TCCTATGACATAGCTAGGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903227804 Original CRISPR CCTCCAAGGCAGAGACCACA TGG (reversed) Intronic
900173274 1:1280972-1280994 CCTCCCAGGCAGAGCCCCCTCGG - Intronic
900357176 1:2270602-2270624 CCTCCCGGGCAGACACCTCACGG + Intronic
901000227 1:6145370-6145392 CCTCAAAAACAGAGGCCACAGGG + Intronic
901002552 1:6155777-6155799 CCTCCTAGGCAGAGACCCTGGGG - Intronic
902734482 1:18391157-18391179 CCTCCTAAGCTGAGACCAGACGG + Intergenic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
905025313 1:34845655-34845677 CCTTCACCCCAGAGACCACAGGG + Intronic
905358086 1:37398869-37398891 ACAGCAAGGAAGAGACCACATGG + Intergenic
905915954 1:41684387-41684409 CCTCCAAGGCCAAGCTCACATGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906933905 1:50195341-50195363 CCTCCCAGCCACAGAACACAGGG - Intronic
908639595 1:66206989-66207011 CATCCAAGGCTGAGTCCACTTGG + Intronic
909162960 1:72177851-72177873 CCTCCAACACAGACAGCACAAGG + Intronic
909658135 1:78053501-78053523 CCTTCCAGGCAAAGACCACCAGG - Intronic
911387215 1:97192226-97192248 CATCCAAGGCAGAGTACCCAGGG + Intronic
913584984 1:120266089-120266111 CCTCCTATGCAGAGGCCATAAGG - Intergenic
913623198 1:120632273-120632295 CCTCCTATGCAGAGGCCATAAGG + Intergenic
914566987 1:148877946-148877968 CCTCCTATGCAGAGGCCATAAGG - Intronic
914605837 1:149252296-149252318 CCTCCTATGCAGAGGCCATAAGG + Intergenic
914799582 1:150950765-150950787 GTCCGAAGGCAGAGACCACAAGG - Exonic
915154205 1:153860906-153860928 CCTCCAAGTCATAAACCACGGGG + Intronic
916267434 1:162904759-162904781 GCACCAAGCCAGAGATCACAGGG - Intergenic
917529226 1:175819121-175819143 CTTCCAATTCAGAGACCTCAAGG - Intergenic
918382327 1:183968700-183968722 CCAGCAAGGCAGAAACAACAGGG - Intronic
918538462 1:185601818-185601840 TCTACAAGCCAAAGACCACAGGG - Intergenic
918795003 1:188883040-188883062 CTTCCAAGGCAGAGAAGAGAAGG - Intergenic
920164032 1:204022886-204022908 CCTCCCAAGCTGAGACTACAGGG + Intergenic
924054280 1:240110103-240110125 CCTGCAGGGCACAGACCGCATGG + Intronic
1066316585 10:34253518-34253540 CCTCCAAGGTAGCAACCAGATGG - Intronic
1067469812 10:46528198-46528220 CCACCAGGGCAGGAACCACAGGG + Intergenic
1067716099 10:48692128-48692150 ACTCGAAGGCTGAGACCACGTGG - Intronic
1070931609 10:80264905-80264927 CCTTCCAGGCAGAGAGAACAGGG - Intergenic
1072705734 10:97679649-97679671 CCCCCAAGGCAGAAACCCCTGGG - Exonic
1073255636 10:102149269-102149291 CCCCCAAAGCAGAGATCAAAGGG - Exonic
1074584415 10:114753209-114753231 CCAGCAAGGCAGAGACTACTTGG + Intergenic
1076272763 10:129169187-129169209 CCTTCAAGGCAGAGAATACAGGG + Intergenic
1077024422 11:432902-432924 CCTCCAAGGCAAAGACCCAGAGG - Intronic
1077378681 11:2217708-2217730 CTTCCAAGGCTGGGTCCACAGGG - Intergenic
1077531931 11:3101463-3101485 CCTCCTAGTCAGAGACCATGTGG - Intronic
1077658000 11:4040802-4040824 CCACCAAGAGAGAAACCACAAGG - Intronic
1080584982 11:33673833-33673855 CCTCCAAATCATAGACAACAAGG - Exonic
1080656684 11:34263859-34263881 CCTCCATGGCAGATACCAGTGGG - Intronic
1082769431 11:57195347-57195369 CATGGAAGGCAGAGATCACAAGG + Intergenic
1083771834 11:64871874-64871896 ACTCCAGGGCAGGGACCACAAGG + Intronic
1084659769 11:70539941-70539963 CCTCCAAGCCAGGGACACCAAGG - Intronic
1084981308 11:72830162-72830184 CTTACAAGGCAGAGCCCACAGGG + Intronic
1087058578 11:93956964-93956986 TCTCCGAGGCAGGGACCTCAGGG - Intergenic
1089639106 11:119835390-119835412 TCCCCAAAGCAGAGACAACATGG - Intergenic
1091296179 11:134475439-134475461 ACTCCAAAGCTGAGTCCACAAGG - Intergenic
1091319708 11:134640837-134640859 CCTTCCAGACAGAGACCCCAGGG - Intergenic
1095908972 12:47406280-47406302 CCTCCAAGGCTCAAACCAAATGG + Intergenic
1101804385 12:108050834-108050856 CCTCCAAGGCTGATAACAAATGG + Intergenic
1101842553 12:108339030-108339052 CCTTCCGGGCAGAGACCAGAGGG - Exonic
1103524913 12:121561133-121561155 CCTTCAAAGCAGGGGCCACAGGG - Intronic
1103610660 12:122122308-122122330 CCTCCCTGGCAGAGCCCCCAGGG - Intronic
1104187821 12:126449380-126449402 ACTCCAGGTCAGAGAACACAAGG - Intergenic
1104323668 12:127775099-127775121 TGTTCCAGGCAGAGACCACATGG - Intergenic
1105330699 13:19412694-19412716 CTCCCAGGGCAGAGCCCACAAGG + Intergenic
1105918773 13:24941468-24941490 CTCCCAGGGCAGAGCCCACAAGG + Intergenic
1106397299 13:29393547-29393569 CCACCAACGCAGAAGCCACATGG + Intronic
1107878634 13:44813730-44813752 CCTCCAGGCAAGAGACCAGATGG - Intergenic
1113567404 13:111327162-111327184 CTGCCAAGGCAGAGTGCACAGGG - Intronic
1113711639 13:112469189-112469211 CATCCAAGGCCTTGACCACATGG - Intergenic
1114420205 14:22575930-22575952 GCTCCCACACAGAGACCACAGGG + Intronic
1114623944 14:24116218-24116240 CCTTGAAGGGAGAGACCACCTGG + Intronic
1118453468 14:65924963-65924985 ACCCCAAGTCAGAGAACACAAGG - Intergenic
1118598516 14:67454635-67454657 CCTTGAAGGCAGAGAACACTTGG - Intronic
1119726479 14:76924705-76924727 CCTCTAAGGCAGCGACCACGTGG - Intergenic
1122247986 14:100417649-100417671 CCTCACTGGCAGAGACAACAAGG - Intronic
1122383687 14:101329383-101329405 CCTCCAAAGCTGAAAGCACAAGG + Intergenic
1123710111 15:22980541-22980563 CCTCCCAGGCAGAGAGCCCCTGG + Intronic
1124085399 15:26545399-26545421 TATCAAAGGCAGAGACCCCATGG - Exonic
1124092904 15:26623262-26623284 ACCCCAGGGCAGTGACCACAAGG + Intronic
1125733629 15:41908662-41908684 CCCACAAGGCAGTGACCACTGGG + Intronic
1127860825 15:62993042-62993064 CCTCAAGGGCAGAGGCCATAAGG - Intergenic
1129184030 15:73894768-73894790 CCCCCATGGCAGAGACCCCCTGG + Intergenic
1129868318 15:78925377-78925399 CCTCAAAGGCAAAGCTCACAGGG + Exonic
1130242848 15:82212912-82212934 CCTCGCAGGAAGAGAGCACAAGG - Intronic
1130457584 15:84128364-84128386 CCTCGCAGGAAGAGAGCACAAGG + Intergenic
1131078390 15:89513649-89513671 CCTTCAATGGAGAGGCCACATGG - Intergenic
1131958046 15:97758966-97758988 CCTCCAAGACAGGCACCACATGG + Intergenic
1132028345 15:98421164-98421186 GCCCCAAGCCAGAGACCCCAAGG - Intergenic
1132207963 15:99999466-99999488 CTTCCAAGGCAGAGGTCACAGGG + Intronic
1132313880 15:100877274-100877296 CCTCAGAGGCAGGGACCACAGGG - Intergenic
1132508980 16:327419-327441 CCTCCTAGGCACAGGCCGCAGGG - Intronic
1132626278 16:893072-893094 CCTGCAAGGAAGAGAGCAGAGGG + Exonic
1133235113 16:4384108-4384130 CATCAAAGGCAGGGACCCCATGG + Intronic
1136081119 16:27853219-27853241 CCCCCAGGGCAGAGGGCACAGGG - Intronic
1139371931 16:66474359-66474381 CCTCCAAGGCATTCTCCACAAGG + Intronic
1139559747 16:67734523-67734545 CCACAGAGGAAGAGACCACAGGG + Intronic
1140506628 16:75477720-75477742 CCTCCAAGGCCTGGACCAGAAGG + Exonic
1140795060 16:78429608-78429630 CCTACATGGCATAGACAACAGGG - Intronic
1141429723 16:83965371-83965393 CCTCCAGGGCAGACAGCTCATGG - Exonic
1142225240 16:88873947-88873969 CCTCCAGGGGCCAGACCACAAGG - Intergenic
1142308150 16:89297077-89297099 GCTCCAAGGCAGAGACCCTGAGG + Intronic
1143806706 17:9434485-9434507 GTTCCAAGGCAGAGAAGACAGGG + Intronic
1144829884 17:18125330-18125352 CATTCTAGGCAGAGGCCACAGGG - Intronic
1146492023 17:33290472-33290494 CCTCCAAGGCAGACTGCACAAGG + Intronic
1146567165 17:33923460-33923482 TTACCAAGGAAGAGACCACAAGG + Intronic
1146689152 17:34861178-34861200 ACACAAAGGCAGAGACCACCAGG + Intergenic
1148805589 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG + Intergenic
1150718594 17:67594554-67594576 CCTCCAAGCAGGAGGCCACAAGG - Intronic
1150789967 17:68195954-68195976 CCTCCAAGGCAGAGGGCCCTGGG + Intergenic
1151433325 17:74079655-74079677 CTTCCAAGGCACAGAGCAGAGGG - Intergenic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1152647680 17:81477271-81477293 CCTCAACCTCAGAGACCACAGGG - Intergenic
1152820498 17:82435437-82435459 CCAACAAAGCAGAGACCACAGGG - Intronic
1152911867 17:83009892-83009914 ACTCCAAGGCAGTGGCCCCAGGG - Intronic
1154324852 18:13382677-13382699 CCCCCAAGGCAGCAAGCACATGG - Intronic
1155209275 18:23586728-23586750 CCTCCAACCCAGAGACGAAAAGG - Exonic
1156370981 18:36470983-36471005 CCTCTAGAGCAGAGACCTCAGGG + Intronic
1157282810 18:46357329-46357351 CCACAAAGGCAGGGACCACCTGG - Intronic
1157843310 18:50979433-50979455 CCTACAATGCAGAGAACTCAAGG - Intronic
1157949897 18:52024378-52024400 CCACCAAGGTACAGAGCACATGG - Intergenic
1158018532 18:52813033-52813055 ACTCCAATGAAGAGAACACATGG + Intronic
1158217503 18:55115496-55115518 CTTCCCAGGCAGAGACCTCATGG - Intergenic
1160940458 19:1618315-1618337 AGACCAAGGCAGAGGCCACAGGG - Intronic
1161581505 19:5083338-5083360 ACCCCAAGGCAGAGACCATGGGG - Intronic
1162117379 19:8439049-8439071 CCTCCCAGGGAGGGACCACATGG + Intronic
1164723634 19:30450963-30450985 CTTCCACGGCAGAGACCGAAGGG - Intronic
1165432298 19:35779895-35779917 CCTCCACAGCAGATGCCACACGG - Intronic
1165930362 19:39354214-39354236 ACTCCAAGGGAGTGACAACATGG - Intronic
1167234197 19:48303824-48303846 CCTCCAACACAGAGACCTCCTGG + Intronic
1167477720 19:49710562-49710584 CCACAATGGCAGCGACCACAAGG - Intronic
1167814770 19:51870025-51870047 CCTCCCAGGGAGGGACCAGAAGG - Intronic
1168042308 19:53768497-53768519 CCGCCAAGGAAGAGCCCACGAGG - Intergenic
1168164536 19:54537622-54537644 ATTCCAAGGAAGAGACCCCAGGG + Intronic
1168179864 19:54654608-54654630 CCTCCAGGGCAGAGACAAGGTGG - Intronic
1168703973 19:58457663-58457685 CCTGCATGGCAGAGACAAAAGGG + Exonic
925216048 2:2096785-2096807 GCTCCCAGGCAGAGGCCCCAGGG + Intronic
925444436 2:3915639-3915661 CCTCCAAGCTATAGCCCACAGGG - Intergenic
925792641 2:7507971-7507993 CTTCCAAGGCAGAGATTAAAAGG - Intergenic
925807932 2:7671022-7671044 CCTCCTAGGTTGAGAGCACAAGG - Intergenic
925992349 2:9263621-9263643 CCTCCGAGGCACAGACCTCCCGG + Intronic
926383287 2:12312459-12312481 CCTCCAAGGGAGAGAAAACAGGG - Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
927988302 2:27428931-27428953 CCGCCAAGCCAGAGACGCCAGGG - Intronic
928626445 2:33144383-33144405 GATCCAAGGCAGAGAGGACATGG - Intronic
929386955 2:41420449-41420471 ACTCCAAGGCAGAAACTAAAGGG - Intergenic
930168236 2:48224497-48224519 ACTCCAAGGCATAAACCCCAAGG + Intergenic
933092472 2:78138013-78138035 CTTCAGGGGCAGAGACCACATGG + Intergenic
933770358 2:85740136-85740158 CCTCCAAGGAAGAGACAACCTGG + Intergenic
933992316 2:87642576-87642598 CTACCAAGGCAGAGACCAGCTGG + Intergenic
934867310 2:97824652-97824674 CTTCCAATGCAGAGACTTCAGGG - Intronic
936301534 2:111308263-111308285 CTACCAAGGCAGAGACCAGCTGG - Intergenic
937064889 2:119010480-119010502 CCTGCAAGGTAGATACTACAAGG + Intergenic
937090657 2:119204137-119204159 CCTCCAAGGAAGGGACCATGGGG + Intergenic
937143825 2:119625455-119625477 ACTGCAAGTCAGAGTCCACAGGG - Intronic
941732573 2:168934550-168934572 CCTCCTAGGCAGAGACAGCATGG - Intronic
944514922 2:200503081-200503103 GCTCCAGGGCAGAGAGCAGAAGG + Intronic
944575785 2:201089951-201089973 CCTCCAAAGGAGAGAACAAAAGG + Intergenic
946413235 2:219526097-219526119 CCTCCCTCGCAGAGCCCACAGGG - Intronic
947264775 2:228266553-228266575 CCTCCAAGGCAAATCCCTCAGGG - Intergenic
947537835 2:230952105-230952127 CCTCAAAGATAGAGACGACATGG + Intronic
948427815 2:237898937-237898959 CACCAAAGGCAGAAACCACAAGG + Intronic
948761822 2:240197099-240197121 CCCACAAGGGAGAGCCCACAAGG + Intergenic
1168773237 20:429130-429152 CCTCTAAGGCAAAGCCCACAAGG - Intronic
1169432078 20:5545541-5545563 GCTCCCAGGCAGAGGACACACGG + Exonic
1171300441 20:24055262-24055284 GCCCCAAGCCAGAGACCACCAGG - Intergenic
1171982543 20:31638051-31638073 CCTCTAAGACAGGGACCACTGGG - Intronic
1173037714 20:39428460-39428482 CCTTCAAGCCTGAGACCCCAGGG + Intergenic
1174206392 20:48843062-48843084 CCTCCCAGGAAGAGACTCCAAGG + Intergenic
1175160360 20:57003656-57003678 CCTGCAGGGCAGTGAGCACATGG - Intergenic
1175861248 20:62151500-62151522 CCTCAGAGCCTGAGACCACAGGG + Intronic
1176059957 20:63168174-63168196 CTTCCAAAGCAGAGAACACAAGG - Intergenic
1177618012 21:23549930-23549952 CCTTCAAGGGAGAGACCAGGTGG + Intergenic
1178668525 21:34569890-34569912 CTTTGAATGCAGAGACCACAGGG + Intronic
1178733796 21:35130931-35130953 CCTCCAAGGGAGAGGCCCCAAGG - Intronic
1180045701 21:45304130-45304152 CCTTCAAGGTAGAGCCCTCAAGG + Intergenic
1180564190 22:16649153-16649175 CTCCCAGGGCAGAGCCCACAAGG - Intergenic
1181424272 22:22822873-22822895 CCTCCAGGGAAGGGGCCACAGGG + Intronic
1181573736 22:23781357-23781379 CCTCGAAGGCAGCGTCCACAGGG - Exonic
1182067171 22:27438853-27438875 CCTCCCAAGCAGACACCTCAGGG - Intergenic
1182111483 22:27726862-27726884 CCTCCCAGCCAGAGGCCACTGGG - Intergenic
1183104241 22:35604929-35604951 CATTCCAGGCAGAGACCTCATGG + Intergenic
1183513813 22:38251555-38251577 CTCCCAAGTCAGTGACCACAAGG + Intronic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
1184662407 22:45971461-45971483 CCGGCAAGGCAGAGCCCACGGGG - Intronic
949844388 3:8354997-8355019 CCTCCAAGACAGAGGGCACAAGG + Intergenic
950106685 3:10393084-10393106 CCTGGAGGGCAGGGACCACAGGG - Intronic
950681609 3:14588892-14588914 CCTCCAAGACAGGGGCCTCATGG + Intergenic
950721452 3:14885630-14885652 TCGCGTAGGCAGAGACCACATGG - Intronic
950889077 3:16387245-16387267 CCGCCAAGGCTGAGGCCACACGG + Intronic
951036179 3:17934830-17934852 CCACCAAGGCAGAAATTACAGGG - Intronic
951651112 3:24952559-24952581 CCTAGAAGGAAAAGACCACATGG + Intergenic
952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG + Intergenic
952843009 3:37664312-37664334 CCTCCAGGTCAGACAGCACATGG - Intronic
953917822 3:46931753-46931775 CCTCCTAGTAACAGACCACAGGG + Intronic
954135047 3:48578605-48578627 CCTCCAGGGTAGAGACCCCCAGG + Intronic
954150147 3:48653224-48653246 CCTCCAAGTCCCAGCCCACATGG - Intronic
954701177 3:52451634-52451656 CCTATCAGGCAGAGGCCACAGGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
954980322 3:54739933-54739955 CCGCAAGGGCAGAGACCATATGG + Intronic
956802192 3:72769758-72769780 GCTCCATAACAGAGACCACATGG + Intronic
959125341 3:102284027-102284049 CCTCAATGGTAGTGACCACAGGG - Intronic
959373853 3:105563609-105563631 ACTTCAAGGAAGAAACCACAGGG - Intronic
962263784 3:133931283-133931305 CCTACAAAGCCGAGACCCCAGGG - Intergenic
964282402 3:155080325-155080347 TCCCCAAGGCAGAGGCCGCAGGG - Intronic
964385165 3:156139450-156139472 CCTCCAGGGCTGAGAACACCTGG - Intronic
966204872 3:177395648-177395670 CCTCCAGGGCAAAGATGACAAGG + Intergenic
966223814 3:177576901-177576923 CCTCCAAGGAGCAGACCACTGGG + Intergenic
966818612 3:183908335-183908357 CCTCCCAGGCCAAGACCACTTGG + Intergenic
968467849 4:761861-761883 CCCCCAAGGCAGTGACACCATGG + Intronic
968708220 4:2093660-2093682 CCCCCAAGACAGAGGCCCCAGGG + Intronic
969270115 4:6093981-6094003 CCTCCCAAGCAGAGATCACATGG + Intronic
969592521 4:8130133-8130155 CCTTCCAGGCTGAGACCACCAGG - Intronic
970126656 4:12820935-12820957 ACTCTAATGAAGAGACCACATGG + Intergenic
970142044 4:12993658-12993680 TCTCCTAGGCACAGACCACATGG + Intergenic
970318495 4:14852550-14852572 CCACCAAGCCAGAAACCTCAGGG + Intergenic
979276113 4:118815690-118815712 CCTCCAAGCCAGGGACCCCCTGG - Exonic
980496822 4:133596492-133596514 CCTCTCAGGAAGAAACCACAAGG + Intergenic
985674519 5:1224108-1224130 CCTCCTGGGCAGATGCCACAGGG - Exonic
985903982 5:2818848-2818870 CCTCCTTGGCAGAGTCCCCAGGG - Intergenic
987979361 5:25061255-25061277 GCATCATGGCAGAGACCACAGGG - Intergenic
989169780 5:38462655-38462677 ACTCCACGGCGAAGACCACAAGG - Intronic
989565187 5:42894537-42894559 TCTCCACAGCAGAGACCTCAAGG - Intergenic
991379319 5:66003244-66003266 CCTGCCTGGCAGAGACCACCAGG + Intronic
992163675 5:74026983-74027005 ACTCCAAGGCAGTGAACTCAAGG - Intergenic
999258842 5:150225415-150225437 CCTCCAAGGCTGAACCCACAAGG - Intronic
1000359989 5:160438202-160438224 CCTTCAAAGCAGCAACCACAGGG - Intergenic
1001982308 5:176045701-176045723 CCTCAAGGGCAAAGGCCACACGG - Intergenic
1002026109 5:176397259-176397281 CCTCAAAGGCAGGGAGCACTGGG + Intronic
1002087674 5:176785951-176785973 CCTCCACGCCAGAGCCCAAAGGG + Intergenic
1002235153 5:177798356-177798378 CCTCAAGGGCAAAGGCCACACGG + Intergenic
1002930820 6:1633799-1633821 GCTCCATGGCAGAAACCACCCGG - Intronic
1003254615 6:4464012-4464034 CCTTCACTGCAGAAACCACAAGG + Intergenic
1003490863 6:6620432-6620454 CCAGCAACGCAGAGGCCACAGGG + Intronic
1005508447 6:26490873-26490895 CCTTCATAGCAGTGACCACATGG + Intergenic
1006448495 6:34092749-34092771 TCTCCAAGGCAGAGCCGACCCGG + Intronic
1006448834 6:34094410-34094432 TCTCCAAGGCAGAGAGGACTGGG - Intronic
1006716185 6:36122235-36122257 TGTCCAGGGCAGAGGCCACAGGG - Intergenic
1006974425 6:38085228-38085250 TCTCCCAGACAGAAACCACATGG + Intronic
1007776638 6:44227682-44227704 CATCTAAGGCAGAGGCCCCAGGG - Intronic
1015871437 6:137780169-137780191 CCACCACAGCAGAGGCCACACGG - Intergenic
1016911384 6:149202595-149202617 GCTACAAGGGAGTGACCACATGG - Intergenic
1017718469 6:157228536-157228558 CCTGCAAGGCAGAGCCCAAGGGG - Intergenic
1018538186 6:164846366-164846388 TCCCCAAGGCAGAGCCAACATGG - Intergenic
1019196139 6:170284219-170284241 TCTACAAGTCAGAAACCACACGG + Intronic
1019391088 7:787224-787246 CCCCCAACCCAGACACCACAAGG - Intergenic
1019721102 7:2571860-2571882 ACTCCCATGTAGAGACCACACGG - Intronic
1021839299 7:24709537-24709559 CCTCCAAGCCAGCGCGCACACGG + Intronic
1024318349 7:48042103-48042125 TCTCCAAGTCACTGACCACAAGG - Intronic
1026950738 7:74344885-74344907 CCTCCATGGCAGAGACACCAGGG + Intronic
1028298806 7:89170677-89170699 CCACCAAGGCAAGGACCTCAGGG - Intronic
1031116047 7:117669976-117669998 TCTCCAAGAAAGAGAACACAGGG - Intronic
1032876636 7:136045352-136045374 CATTCCAGGCAGAGAACACAAGG + Intergenic
1032970382 7:137156311-137156333 CAGCCTAGGCAGAGGCCACAGGG - Intergenic
1033008282 7:137591096-137591118 TCACAAAGGCAGAGCCCACAGGG + Intronic
1033667129 7:143452185-143452207 TCTCCAACACACAGACCACATGG + Intergenic
1033672439 7:143505804-143505826 TCTCCAAGGGAGGGACCAGATGG + Intergenic
1034556029 7:151850940-151850962 GCTCCAAGGCACGGCCCACAGGG + Intronic
1034803580 7:154068505-154068527 CCTCCAAGGCCGGGGCCACTGGG - Intronic
1034959921 7:155358755-155358777 CCCGCAGTGCAGAGACCACAGGG - Exonic
1035160349 7:156945204-156945226 CCTCCAAGACAGGGAGCCCAGGG + Intergenic
1036825755 8:11974627-11974649 CCTCCCAGGCAGACACCACTGGG - Intergenic
1038497261 8:28012371-28012393 TCTCCAAAGCATAGAACACATGG + Intergenic
1038800697 8:30746062-30746084 TCTTGAAGGCAGAGACCAAATGG + Intronic
1040998245 8:53423522-53423544 TCTCCCAGGCAGAGAACCCAAGG - Intergenic
1042490716 8:69394347-69394369 AGCCCAAGGTAGAGACCACACGG + Intergenic
1042776515 8:72438288-72438310 CGTTCAAGAAAGAGACCACAGGG - Intergenic
1043746884 8:83885513-83885535 CCTCCAGGGAATAGAACACAGGG - Intergenic
1048636365 8:136300272-136300294 GCTCCAACTCACAGACCACATGG - Intergenic
1048969531 8:139637267-139637289 CTTCCTTGGCAGAGACCGCAAGG + Intronic
1049500194 8:142958933-142958955 CCCCGAAGGCAGAGACCAAAAGG - Intergenic
1051365067 9:16316182-16316204 CCTCCAGGGAACAGACCCCAGGG - Intergenic
1052817592 9:33113586-33113608 CCTACAAGGAAAAGAGCACAAGG + Exonic
1053134289 9:35640373-35640395 ACCCCAAGTCAGAGAACACAAGG - Intronic
1056692302 9:88818067-88818089 GCCTCAAGGCAGAGACCACAAGG - Intergenic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1058100356 9:100912718-100912740 CCACCAAGTCAGAGAGCAGACGG - Intergenic
1058114055 9:101064942-101064964 TCTCAAAGGCAGAGCCCTCATGG - Intronic
1060776919 9:126381448-126381470 CCTCCAAGCAACAGATCACAGGG + Intronic
1061564558 9:131429430-131429452 CTAGCAAGGGAGAGACCACATGG - Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1062200378 9:135299780-135299802 CTCCCCAGGCAGAGCCCACATGG + Intergenic
1062620306 9:137417548-137417570 TCTCCCGGGCAGAGACCACGGGG + Intronic
1185890259 X:3816182-3816204 CCTCCCAGGCAGCGACCGCAGGG - Intergenic
1186144955 X:6615571-6615593 CCTCTGAGGTAGAGAGCACAAGG + Intergenic
1187210815 X:17229724-17229746 CCTCCAAGACAGTGACCACTGGG - Intergenic
1191650918 X:63537015-63537037 CCTCGTGGGCATAGACCACATGG + Intergenic
1193455752 X:81729627-81729649 CCCACAAGGCAGACACCACATGG - Intergenic
1194866255 X:99071932-99071954 TCAGCAAGGCAGAGACCACGAGG - Intergenic
1196717287 X:118823929-118823951 CCTGCAAGGCGGAGACCAGAAGG + Exonic
1198560951 X:137849486-137849508 CCCCCAAGACAGGGACCAGAAGG + Intergenic
1198573184 X:137980338-137980360 TTTCCAATGAAGAGACCACATGG + Intergenic
1199678804 X:150210494-150210516 GGTCCAAGGCTGAGATCACAGGG + Intergenic
1200396830 X:155995454-155995476 CCTCAGAAGCAGAGACCACAAGG - Intergenic
1200834503 Y:7719838-7719860 CCACCAAGGCAGAGAGAATATGG - Intergenic
1201914612 Y:19168686-19168708 CCTCCAAGGCAGTTATCCCAAGG - Intergenic
1201980861 Y:19909003-19909025 GCTGCAAGGCAGCGCCCACACGG - Intergenic
1202097909 Y:21272921-21272943 CCTGCAAGCCAAACACCACATGG + Intergenic
1202600634 Y:26590115-26590137 CTCCCAGGGCAGAGTCCACATGG - Intergenic