ID: 903230429

View in Genome Browser
Species Human (GRCh38)
Location 1:21919028-21919050
Sequence CCCCATCTTTCCCCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903230420_903230429 17 Left 903230420 1:21918988-21919010 CCGCCCTACAGGCCATGTCAGTA 0: 1
1: 0
2: 1
3: 5
4: 75
Right 903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 235
903230421_903230429 14 Left 903230421 1:21918991-21919013 CCCTACAGGCCATGTCAGTAGAG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 235
903230419_903230429 18 Left 903230419 1:21918987-21919009 CCCGCCCTACAGGCCATGTCAGT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 235
903230422_903230429 13 Left 903230422 1:21918992-21919014 CCTACAGGCCATGTCAGTAGAGA 0: 1
1: 0
2: 2
3: 11
4: 101
Right 903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 235
903230423_903230429 5 Left 903230423 1:21919000-21919022 CCATGTCAGTAGAGAACCGCTTT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903230429 Original CRISPR CCCCATCTTTCCCCAAAGGC AGG Intronic
900806625 1:4771804-4771826 CATCAGCTTTCCCCAAAGACAGG + Intronic
900919354 1:5660967-5660989 TCTCATCTTACCCCAGAGGCAGG + Intergenic
902453686 1:16516119-16516141 CCAGTTCTTTCCACAAAGGCTGG - Intergenic
902473739 1:16668783-16668805 CCAGTTCTTTCCACAAAGGCTGG - Intergenic
902485064 1:16738659-16738681 CCAGTTCTTTCCACAAAGGCTGG + Intergenic
902498798 1:16894143-16894165 CCAGTTCTTTCCACAAAGGCTGG + Intronic
903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG + Intronic
903667493 1:25016971-25016993 CCCCATCTCACCCCACAGGATGG - Intergenic
905136278 1:35802957-35802979 CCCCAGCTTTCCTCAAAGTGTGG - Intergenic
905153669 1:35954779-35954801 CCTCCTCCTTACCCAAAGGCAGG - Intronic
905549986 1:38829898-38829920 TCCCATTTTTACCTAAAGGCAGG + Intergenic
905884307 1:41483554-41483576 CCCCATCCTCCCCATAAGGCAGG - Intronic
906674922 1:47686780-47686802 GCACCTCCTTCCCCAAAGGCAGG + Intergenic
912546963 1:110457800-110457822 CTCCATCTTAACCCAGAGGCTGG + Intergenic
913513610 1:119584126-119584148 GCCACTCTGTCCCCAAAGGCAGG + Intergenic
913517234 1:119615044-119615066 GCCACTCTGTCCCCAAAGGCAGG + Intergenic
914005805 1:143731463-143731485 CCAGTTCTTTCCACAAAGGCTGG - Intergenic
914517986 1:148390483-148390505 CCAGTTCTTTCCACAAAGGCTGG - Intergenic
915446585 1:155977932-155977954 CCCCATCACTCCCCAATCGCTGG - Intronic
916886994 1:169079282-169079304 TCCCCTGTTTCTCCAAAGGCTGG - Intergenic
917141677 1:171841640-171841662 CCCCATCTTGCCCGAGGGGCCGG - Exonic
917535133 1:175868995-175869017 CCTCACCTTACCCCACAGGCAGG - Intergenic
917574335 1:176305168-176305190 CCTAATCTTTCCCCAAGTGCAGG + Intergenic
919839073 1:201596256-201596278 CCCCATCTCTCCCATCAGGCTGG + Intergenic
920301308 1:204990787-204990809 CAGCATCTTCCCCCAAAGACAGG + Intronic
920421831 1:205840064-205840086 CCCCATGTTTACCCAAACCCAGG + Intronic
920499253 1:206476165-206476187 CCCCGTCTGTCCCCAGTGGCCGG + Exonic
920986734 1:210897701-210897723 TCCCTACATTCCCCAAAGGCAGG - Intronic
921681887 1:218043520-218043542 CCCTTCCTTTCCCCACAGGCAGG + Intergenic
922933619 1:229408231-229408253 GCCCACCTTGCCCCACAGGCAGG - Intergenic
1064122643 10:12633196-12633218 CCCCATCTTCTCCCAAAGTGTGG - Intronic
1064659561 10:17592734-17592756 CCCTCTCTTTTCCCAATGGCAGG - Intronic
1068523723 10:58105250-58105272 AGCCATTTTTCCTCAAAGGCTGG + Intergenic
1068928653 10:62565842-62565864 CACCAGCTTTCCCACAAGGCTGG - Intronic
1069102093 10:64334827-64334849 GCCCATATTTTCCCAAAGGTGGG + Intergenic
1071573692 10:86711410-86711432 CCGCCTCTTTCCCCCTAGGCAGG - Intronic
1071715983 10:88095931-88095953 CCCCTTCTATCCTCAAAGCCCGG + Intergenic
1071859638 10:89659073-89659095 CTCCAGCTTTCCCCAAAGGATGG + Intergenic
1072451242 10:95541310-95541332 CGCCCTCTTTCCCCAACAGCGGG + Intronic
1072727230 10:97822101-97822123 CCCCATCTGTCTCCCAAGCCTGG + Intergenic
1072955643 10:99885638-99885660 CCCCCTCTTTACCCCGAGGCGGG + Intronic
1073956249 10:108874663-108874685 CCCCACATTTCCCCAAGTGCTGG - Intergenic
1074453453 10:113577907-113577929 ACCCATCTTTCGCGAAAGGATGG + Intronic
1075195831 10:120358400-120358422 CCCCACTTTTCCCCAGAGGATGG + Intergenic
1075301591 10:121329407-121329429 TCCCATCACTCCCCAAGGGCTGG + Intergenic
1077162808 11:1121358-1121380 CCCCCTCCTGCCCCAACGGCCGG + Intergenic
1077266712 11:1654538-1654560 CTCCAGCCTTCCCCACAGGCTGG - Intergenic
1078926468 11:15879960-15879982 CCCCATCTAGGCCCATAGGCTGG + Intergenic
1080408029 11:31997225-31997247 CCCCATGATGCCCCAAATGCAGG - Intronic
1082193479 11:49274217-49274239 CCCCCCAGTTCCCCAAAGGCTGG + Intergenic
1083302075 11:61744690-61744712 CCCCATCTTTCCCCATCTGTGGG - Exonic
1084038209 11:66526246-66526268 CCTCCTCTTTCCCCAGAAGCAGG - Intronic
1087158444 11:94926680-94926702 CTCCTGCTTTCCCCATAGGCAGG + Intergenic
1088815483 11:113417951-113417973 CCCCAGCTTTTCTCAAAGCCAGG - Intronic
1088899471 11:114104331-114104353 CTCCGTCTTTCCCCAATAGCAGG - Intronic
1090629089 11:128630642-128630664 CACCATCTAGGCCCAAAGGCAGG + Intergenic
1092083773 12:5739041-5739063 CCACCTCTTTCCCCAGAGGAGGG + Intronic
1092233194 12:6789260-6789282 CCACTTCTTTCCCCACAGCCTGG + Intronic
1096466934 12:51851803-51851825 CCCCATCCTTCCCCCAACCCGGG - Intergenic
1097233204 12:57524356-57524378 CCACATCTGTCCCCATCGGCTGG + Exonic
1100103512 12:91139924-91139946 CCCCCTCTTTCCACAAAACCAGG - Intergenic
1101352695 12:103946951-103946973 CCCAACCTTCCCGCAAAGGCTGG + Intronic
1102232101 12:111269790-111269812 TCTCCTCTTTCCCCAAAGCCCGG + Intronic
1102321255 12:111936653-111936675 CCTCATCTCTCCACAAAGGAAGG + Intronic
1103783017 12:123412115-123412137 CCCTATCTATCCCCACAGGGAGG + Exonic
1105207980 13:18238998-18239020 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1105602011 13:21895904-21895926 CCACATCTTTATCCAAAGCCTGG + Intergenic
1106836699 13:33642751-33642773 CCCTGTGTTTCCTCAAAGGCCGG + Intergenic
1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1115369559 14:32596818-32596840 CCCCACCTTTTCCCAAGGGAAGG - Intronic
1117746972 14:58879585-58879607 ACCCATCTGGCCCCAAATGCTGG - Intergenic
1118231389 14:63953742-63953764 CCCCATCATCCCCCAAACCCTGG + Intronic
1118715301 14:68555566-68555588 GCCCTGCTGTCCCCAAAGGCAGG - Intronic
1122075909 14:99234370-99234392 CCCCATCCTTCCTCAGAGGAGGG + Intronic
1122157428 14:99758506-99758528 CCCCACATTTGACCAAAGGCAGG + Intronic
1127831109 15:62752359-62752381 CCCACACATTCCCCAAAGGCAGG - Exonic
1130626291 15:85518942-85518964 CCTCCTCTGTCCCCAAAGGAAGG + Intronic
1130889422 15:88120629-88120651 TCCTATCTTTCCCCAAGGCCAGG + Intronic
1131182325 15:90249302-90249324 TCCCATCTTTCCCTAAACCCCGG - Intergenic
1131183502 15:90256350-90256372 CCTCATCTCTCCCAAAAGCCAGG + Intronic
1131455747 15:92581065-92581087 CTCTCTCTTACCCCAAAGGCAGG + Intergenic
1131510875 15:93048833-93048855 CCCCATCCTCCCCCCATGGCAGG - Intronic
1132588934 16:717990-718012 GCCCATTCTTCCCCAAGGGCGGG - Exonic
1136115829 16:28093675-28093697 CCTCAGCTTTTCCCAAGGGCTGG + Intergenic
1136315694 16:29453728-29453750 CCCCATCTCTCGCCCCAGGCTGG - Exonic
1136430271 16:30193070-30193092 CCCCATCTCTCGCCCCAGGCTGG - Exonic
1137434137 16:48441733-48441755 CCCCACCTTGCCTCAAAGGGAGG - Intronic
1137672258 16:50285803-50285825 CCCCATCAGTCTCCAAAGGTAGG - Intronic
1137746573 16:50824780-50824802 CCCCCTCTTTCCTCAAAGTGTGG - Intergenic
1138257569 16:55580069-55580091 CCCAGTCTTTCCCCTGAGGCTGG + Intronic
1138264120 16:55647312-55647334 CCCCATCTATACCAAAAGGAAGG + Intergenic
1138392028 16:56676907-56676929 CACCTTTTTTCCCCACAGGCTGG - Intronic
1138517002 16:57541668-57541690 CTCCATCTTTCCCCCAGGGCTGG + Intergenic
1140045289 16:71436584-71436606 CCCCATCTTTGCACAGACGCTGG - Intergenic
1143125422 17:4638680-4638702 CCCCATCCTGCCCTGAAGGCTGG - Exonic
1143584674 17:7845178-7845200 CCTTAGCTTTCCCCAAAGGGAGG - Intronic
1146482190 17:33213710-33213732 CCCCTTCTTTCCACCCAGGCTGG + Intronic
1147992832 17:44345547-44345569 CCCCAGCATTCCCCCAAAGCAGG + Intronic
1148097260 17:45061081-45061103 CCCCTTCTTTCCTCAAAGCGTGG + Exonic
1148160506 17:45447286-45447308 CCTCTTCTTTTCCCAAAGCCTGG + Intronic
1150391796 17:64794166-64794188 CCTCTTCTTTTCCCAAAGCCTGG + Intergenic
1151847047 17:76663917-76663939 CCCCTTTTTTGCCTAAAGGCAGG - Intergenic
1152363861 17:79844317-79844339 GCCGATCGATCCCCAAAGGCGGG + Intergenic
1157694357 18:49708924-49708946 GCCCATGTTTCCCCAGAGTCAGG - Intergenic
1158049239 18:53195467-53195489 CCACATTTTTCCCCAAAGCATGG - Intronic
1158162831 18:54505612-54505634 CCCCATCTTTCCCCACTAGAAGG - Intergenic
1159136940 18:64347691-64347713 CCCCAGCTTAGCCCTAAGGCTGG - Intergenic
1159552622 18:69911269-69911291 CCCCATCTTTCCCTTGAGGAAGG + Intronic
1160388435 18:78512285-78512307 ACCCCTCCTTCCCCAGAGGCAGG + Intergenic
1160399244 18:78597944-78597966 CACCATCTTTCCCCAGTGGCAGG + Intergenic
1160399253 18:78597978-78598000 TACCATCTTTCCCCAGTGGCAGG + Intergenic
1160399269 18:78598046-78598068 TACCATCTTTCCCCAGTGGCAGG + Intergenic
1161283880 19:3459169-3459191 CCCCCTCCTCCCCCAAAGCCTGG + Intronic
1162017595 19:7853784-7853806 CTCCATCTTTCCCCAGAGGGCGG - Intronic
1163297310 19:16420784-16420806 ACCCCTCTTTCCCCCAGGGCTGG - Intronic
1164974877 19:32565215-32565237 GCCCATCTTTACAGAAAGGCGGG - Intergenic
1166075497 19:40411663-40411685 CCCCACCTTACCCCAGGGGCTGG - Intronic
1167080329 19:47273341-47273363 CCCCTTCTCTCCTCAGAGGCAGG + Intergenic
1167210041 19:48128460-48128482 CCCCATGATTCCCCAAAGCTGGG + Intronic
1167461155 19:49625400-49625422 CCCCTTCCCTCCCCAGAGGCCGG + Intronic
1168283717 19:55320272-55320294 GCCCCTCTTTCCCCAAAATCCGG - Intronic
1202705932 1_KI270713v1_random:23858-23880 CCAGTTCTTTCCACAAAGGCTGG - Intergenic
926424559 2:12729116-12729138 CGCCAGCCTTCCCCAAAGGTTGG - Intronic
927920014 2:26965130-26965152 CCCCATGTTTCCCCATAGGAGGG - Intergenic
929591374 2:43149291-43149313 CACCAGCTTTCCCCAAATCCCGG - Intergenic
932863568 2:75318763-75318785 ACTCATCATTCCTCAAAGGCTGG + Intergenic
935063732 2:99630500-99630522 CCCTCTCTTTCCACCAAGGCAGG - Intronic
935191249 2:100780452-100780474 CCCCATCTTTCCCCTAGGCCAGG + Intergenic
935515079 2:104026639-104026661 CTCTTTCTTTCACCAAAGGCAGG + Intergenic
938150324 2:128876589-128876611 CCCCACCTTCCCCCATGGGCTGG - Intergenic
941155563 2:161973486-161973508 TTCCATCTTTCCTCAAAGGGTGG - Intronic
942094340 2:172523427-172523449 CTCCAACTTTCTCCAAATGCCGG + Intergenic
944081012 2:195788302-195788324 CTCCATCTTCCCCCAAGGGCAGG + Intronic
946021799 2:216645308-216645330 CCCCATCTTTCCCTAGAAGTAGG - Intronic
947110334 2:226711252-226711274 CCCCAGCCTTCTTCAAAGGCTGG - Intergenic
947447522 2:230175594-230175616 CCCCATCTTGCCCTGGAGGCTGG - Intronic
947920117 2:233863133-233863155 CCTCAGCCTTCCCCAATGGCTGG - Intergenic
948156663 2:235788724-235788746 CCCCTTCTTTCCCAAATGGTGGG + Intronic
1169155624 20:3327359-3327381 CCCCATCTTTCCCCACTCCCAGG - Intronic
1169232033 20:3896592-3896614 CCCCACCCCTCCCCAGAGGCTGG - Intronic
1169456092 20:5753840-5753862 CCTCATCTTGCCCCAAATGGGGG + Intronic
1169893636 20:10479174-10479196 CCTCACCTTTCCCAGAAGGCTGG - Intronic
1170324217 20:15137857-15137879 CCCCATCTTTTTCCAAAGGCAGG - Intronic
1171173443 20:23034939-23034961 GCACATCTTTACCCAAAGGGAGG + Intergenic
1172021759 20:31919732-31919754 CCCCAACTCTCCCCAGAGGAAGG - Intronic
1173124332 20:40322699-40322721 AACCATCTTTCCCGAAAGTCAGG + Intergenic
1173422422 20:42914350-42914372 CCCCCTCTTTCCCAGAAGCCGGG + Intronic
1174476854 20:50801878-50801900 CCTCATCTTTCCCCTGTGGCCGG - Intronic
1175471198 20:59229918-59229940 CTCCAGCATTCCCCAAAGCCAGG - Intronic
1176083209 20:63284321-63284343 CCTCCTCTTCCCCCAAAGGCAGG - Intronic
1176377043 21:6091951-6091973 CCCCATCCACACCCAAAGGCAGG + Intergenic
1177460073 21:21397625-21397647 CTCCCCCTTCCCCCAAAGGCTGG - Intronic
1178317947 21:31582704-31582726 GCCCTTCTTTATCCAAAGGCTGG - Intergenic
1179746432 21:43446293-43446315 CCCCATCCACACCCAAAGGCAGG - Intergenic
1180758545 22:18180883-18180905 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1180768832 22:18364675-18364697 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1180777480 22:18497720-18497742 CTCCATCTTCCCCAAAAGACAGG - Intergenic
1180810200 22:18755030-18755052 CTCCATCTTCCCCAAAAGACAGG - Intergenic
1180826707 22:18867899-18867921 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1181196344 22:21189282-21189304 CTCCATCTTCCCCAAAAGACAGG - Intergenic
1181213183 22:21303842-21303864 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1181523833 22:23466829-23466851 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1181586771 22:23857024-23857046 CCCGACCTTTCCCCAGAGGACGG - Intronic
1182812243 22:33126926-33126948 CTGATTCTTTCCCCAAAGGCAGG + Intergenic
1183716725 22:39537588-39537610 CCCCATCTTTCTCCAGGGACTGG - Intergenic
1183760004 22:39807437-39807459 CCTGATCTTAGCCCAAAGGCCGG + Intronic
1184271646 22:43387861-43387883 GCAGCTCTTTCCCCAAAGGCTGG - Intergenic
1184345324 22:43909454-43909476 CTCCATCTTTTCCCCAAGGAGGG - Intergenic
1184925479 22:47633400-47633422 CCCCAGCTATACCCGAAGGCCGG - Intergenic
1203230454 22_KI270731v1_random:105559-105581 CTCCATCTTCCCCAAAAGACAGG + Intergenic
1203276850 22_KI270734v1_random:93809-93831 CTCCATCTTCCCCAAAAGACAGG + Intergenic
949312199 3:2712744-2712766 CCTCTTCTTTCCCCAAAGGTTGG - Intronic
949533482 3:4978790-4978812 CCCCAGCCTTCCCCAGAGGCTGG - Intergenic
949796335 3:7855306-7855328 CCCCATATTCACCCAAAGCCTGG - Intergenic
950230395 3:11271059-11271081 CCCCCACCCTCCCCAAAGGCAGG - Intergenic
950449029 3:13055218-13055240 CCCCATCTGCCCCCAGAGGAGGG - Intronic
951407203 3:22315699-22315721 CTCCATCTTGCCTCACAGGCTGG + Intronic
952939499 3:38431714-38431736 ACTCATGTTTCCCCTAAGGCTGG + Intergenic
953982940 3:47421773-47421795 GCCCGTCTTTCCCCCAGGGCTGG - Intronic
957542727 3:81595046-81595068 ACTCATCTTTCCCCAAAGTTTGG - Intronic
961204543 3:125071185-125071207 CCACATCTTGCCCCAGTGGCAGG + Intergenic
962768722 3:138593104-138593126 CCACCTCTTCCCCAAAAGGCGGG + Intronic
963790262 3:149576030-149576052 TCACAGCATTCCCCAAAGGCTGG + Intronic
966032731 3:175370649-175370671 CTCCAGCTTTCCACATAGGCAGG + Intronic
966898870 3:184466153-184466175 GCACATCTTTCCTCAAAGGAGGG + Intronic
970450672 4:16164071-16164093 GCCCAGCTGTCCCCAAAGCCAGG - Intronic
973596294 4:52493934-52493956 CCCCATCTTTGTCAAAAGTCAGG - Intergenic
976843322 4:89457630-89457652 CCTCTTATCTCCCCAAAGGCTGG + Intergenic
980138092 4:128880549-128880571 CCAGATCTTTGCCCAAATGCAGG - Intronic
980751368 4:137093993-137094015 CCCAATCTTTCCCCATATGCTGG + Intergenic
982203104 4:152976974-152976996 CCCCACCCTCCCCCAAAGCCCGG + Exonic
984287067 4:177744397-177744419 CTCCATCTTGACCCATAGGCAGG + Intronic
986425224 5:7624514-7624536 CCCCATCCTCCCCCATAAGCAGG - Intronic
987858740 5:23456262-23456284 CCACATCTCTCCCCACAGCCTGG - Intergenic
992228217 5:74639882-74639904 CCCCAACTTTCCTCCAAGCCGGG + Intronic
994819977 5:104636995-104637017 CCCCATCTTTTCCCATTGGAAGG - Intergenic
996571404 5:124935986-124936008 CCCCTTCCCTCCCCAGAGGCTGG + Intergenic
997830318 5:137144125-137144147 CCTGATCTTTCCCCAGAGGCTGG + Intronic
998148913 5:139746156-139746178 CCCCATCTTCCCTCAAAGCTTGG + Intergenic
999145448 5:149390229-149390251 ACCCATCTTTCCCCAGGGACAGG - Intronic
1001650846 5:173315149-173315171 CCACATCCTTCCTCAAAGGAAGG + Exonic
1003190437 6:3869806-3869828 CCCCATGTTTCCCATCAGGCAGG - Intergenic
1004239976 6:13912215-13912237 CCCCATCTGTCTCCATAGCCTGG - Intergenic
1005990623 6:30899579-30899601 CCCCACCCTTCCCCAAGGGATGG - Intronic
1006151307 6:31991661-31991683 CCCCACCTTCCCCCCAAGTCAGG - Intronic
1006157608 6:32024399-32024421 CCCCACCTTCCCCCCAAGTCAGG - Intronic
1006461066 6:34158435-34158457 CCCCATCTTCCCCCAGTAGCTGG - Intergenic
1006573461 6:35025002-35025024 CCTAATCTTTCCCCAGAGGTAGG - Intronic
1008185938 6:48389878-48389900 CCCCATCTGTCCACAAGGCCAGG + Intergenic
1008544935 6:52576383-52576405 CCCCCTCTTGCCCCAAGGGGTGG - Intronic
1011794758 6:90940119-90940141 TCCCTGCTTGCCCCAAAGGCAGG - Intergenic
1014219211 6:118783093-118783115 CCCAGTCCTCCCCCAAAGGCTGG + Intergenic
1015602454 6:134923804-134923826 CTCCATCTTCCCCTAAAGGAAGG - Intronic
1017817415 6:158026049-158026071 CTCCATCTAGCCCCAAAGTCCGG - Intronic
1018773128 6:166989639-166989661 CCCTTTCTTTGCCTAAAGGCAGG - Intergenic
1020355469 7:7271070-7271092 CCCTTTTTTTCCCCAAAGGATGG + Intergenic
1022776521 7:33532943-33532965 CTCCATCTGTACACAAAGGCTGG - Intronic
1024919490 7:54542717-54542739 CCCCATCATTCCAAAAAGGGAGG - Exonic
1025258377 7:57400237-57400259 CCCCATCCTCCCCCAAAGTGAGG - Intergenic
1027173571 7:75889382-75889404 CCCCAGCTGTCCTCAAGGGCTGG - Intergenic
1029592877 7:101518910-101518932 CCCAATCTGTCCCCAACGGAGGG + Intronic
1031011814 7:116532457-116532479 CCTCAACTTTCCCCACAGCCAGG - Intronic
1032332320 7:130992033-130992055 CCCCATTCTTCCCCAAAGTGGGG + Intergenic
1033257227 7:139812660-139812682 CACCACCTTTCCCCAAAAACTGG - Intronic
1033360466 7:140635645-140635667 CCCCTTCCTTCCCCAAGGCCAGG + Intronic
1033877732 7:145842870-145842892 CTCCACCTTTCCCCAACTGCAGG - Intergenic
1034744133 7:153507350-153507372 CCCCCTCCTTCTCCAAAGCCAGG - Intergenic
1035029902 7:155850029-155850051 CCCCACCCTTCCCCAGAGCCTGG - Intergenic
1035091486 7:156316541-156316563 TCCCTTCATTCCCCAAAGCCAGG + Intergenic
1035447743 7:158954447-158954469 CTCTATGTTTCCCAAAAGGCTGG - Intronic
1035737447 8:1898741-1898763 TCCCCTCTGTCCCCCAAGGCTGG - Intronic
1036635986 8:10549720-10549742 CTCCGTCTTTCTCCAAAGTCAGG - Intronic
1038123777 8:24647953-24647975 CCCCACACTTCCCCAAAGGTTGG - Intergenic
1039546583 8:38415094-38415116 TCCCTTCCTTCCCCAAAGACTGG + Intronic
1042339871 8:67667351-67667373 CCCCAGGTTTCCCCAAGAGCAGG + Intronic
1042999354 8:74738311-74738333 ACCCTTGTTTCCCCAAATGCTGG + Intronic
1043385510 8:79744068-79744090 ACCCATCTTTCCCCAGAGTGAGG + Intergenic
1044319982 8:90791318-90791340 GCCCGACCTTCCCCAAAGGCGGG - Intronic
1048676574 8:136790225-136790247 GCCCATATTTGCCCAAAAGCTGG + Intergenic
1049357276 8:142195141-142195163 CCCCAGCTGTCCCCAAGGGCAGG + Intergenic
1049802746 8:144525763-144525785 CCCCATCTATCCCCAAAGACAGG - Exonic
1057463545 9:95290228-95290250 CCCCAGAGTTCCCCAAAGGATGG - Intronic
1061080735 9:128368422-128368444 CCCCATCTCTACCAAAAGCCAGG - Intergenic
1186301354 X:8203207-8203229 CCTCATCTTTCCCCAATCTCTGG + Intergenic
1189192347 X:39121511-39121533 CCGTATCATTCCCCAAAGACAGG - Intergenic
1195926107 X:110026419-110026441 ACCCATGTTTTCCCGAAGGCTGG - Intronic
1195997598 X:110746648-110746670 CCTCATCTTTTCCCTGAGGCTGG + Intronic
1197819180 X:130528985-130529007 CCCCCTCTTTCTTCAAAGGGTGG - Intergenic
1199262793 X:145795165-145795187 CCCTCTCTTTCCCCATATGCAGG + Intergenic
1201532286 Y:15005206-15005228 GCACACCATTCCCCAAAGGCTGG + Intergenic