ID: 903232701

View in Genome Browser
Species Human (GRCh38)
Location 1:21931576-21931598
Sequence TGACCCCTCATAGCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903232695_903232701 6 Left 903232695 1:21931547-21931569 CCAAGTCATATTCACTTCCTCCT 0: 1
1: 0
2: 1
3: 19
4: 276
Right 903232701 1:21931576-21931598 TGACCCCTCATAGCTGGGACTGG 0: 1
1: 0
2: 0
3: 8
4: 117
903232694_903232701 14 Left 903232694 1:21931539-21931561 CCGGGGAACCAAGTCATATTCAC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 903232701 1:21931576-21931598 TGACCCCTCATAGCTGGGACTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903232701 Original CRISPR TGACCCCTCATAGCTGGGAC TGG Intronic
900041045 1:464646-464668 TGACCCCTTTTAGCTGTGGCTGG + Intergenic
900062476 1:699622-699644 TGACCCCTTTTAGCTGTGGCTGG + Intergenic
900837117 1:5013711-5013733 TGAGCTCTCCTACCTGGGACTGG - Intergenic
900991931 1:6102054-6102076 GGCCCCCTCTTAGCTGGGCCTGG + Exonic
902628537 1:17690736-17690758 TGACCCCTCATATCTGAGAGTGG + Intronic
903232701 1:21931576-21931598 TGACCCCTCATAGCTGGGACTGG + Intronic
904575750 1:31504063-31504085 TGTCCCCACATAGCTGGGGTGGG + Intergenic
904889851 1:33771657-33771679 TGATCCCTCAGGGCTGGGAGAGG - Intronic
906103402 1:43277366-43277388 TGTCCCTTCATATCTGAGACTGG + Intergenic
907714240 1:56912657-56912679 TGGCCCCTTTGAGCTGGGACAGG - Intronic
911164370 1:94711992-94712014 GGAGCCCTCATGGATGGGACTGG - Intergenic
916644466 1:166769268-166769290 TGAACCCAGATAGCTGGGACTGG - Intergenic
922464563 1:225838375-225838397 TGCCCCCTGACAGCTGGGCCAGG - Intronic
1069912937 10:71770890-71770912 TGACCCCTCATGCCAGGGACTGG + Intronic
1076341310 10:129747779-129747801 TGGCCCCTCTTGGCTGTGACAGG + Intronic
1076967318 11:100876-100898 TGACCCCTTTTAGCTGTGGCTGG + Intergenic
1077062953 11:625752-625774 TGGCCTCTCATGGCTGGGGCTGG + Intronic
1077251799 11:1564045-1564067 TGAGCCAGCATATCTGGGACGGG - Intronic
1077384915 11:2264250-2264272 CTACCCCTCAGAGCTGGGGCAGG - Intergenic
1077423717 11:2464765-2464787 TGACCCCTCCTAGGTGGGCTGGG + Intronic
1083609583 11:63998649-63998671 CGACCTCTCAGAGCTGGGAGCGG + Exonic
1092791168 12:12072088-12072110 ACACCCCTCACCGCTGGGACAGG + Intronic
1095909435 12:47411090-47411112 TGACACCTCACACCTGGCACAGG + Intergenic
1096554509 12:52395148-52395170 TGACCCCACATGGCTCGTACAGG + Exonic
1099083797 12:78219895-78219917 AGAGTCCTCATAGATGGGACGGG - Intergenic
1099832168 12:87857782-87857804 TGACTCCTCATGGCTTGCACAGG + Intergenic
1101579884 12:106033076-106033098 TGATGCCTCTTAGCTGGGAGGGG - Intergenic
1102749592 12:115280837-115280859 TGAGCCCTCATGGCTGGGTGTGG + Intergenic
1114080919 14:19200917-19200939 TGACCCCTGACACCTGGGGCTGG - Intergenic
1117215618 14:53548768-53548790 TGACTTCTGGTAGCTGGGACTGG + Intergenic
1119486121 14:74988173-74988195 TGGCCCCCCACACCTGGGACTGG - Intergenic
1121372223 14:93369956-93369978 TCACCCCTCTTAAGTGGGACAGG - Intronic
1122201409 14:100124808-100124830 TGACCCCACACAGCTTGGATTGG - Intronic
1123581786 15:21721077-21721099 TGGGCCCTCACACCTGGGACAGG + Intergenic
1123618435 15:22163677-22163699 TGGGCCCTCACACCTGGGACAGG + Intergenic
1124638381 15:31379543-31379565 AGACCCCTCATTCCTGGGATGGG - Intronic
1130070079 15:80639775-80639797 GGGCCCCTCATATCTGGTACAGG - Intergenic
1131442575 15:92470035-92470057 TGGCCGCTCATAGCTGGTTCTGG - Intergenic
1133326369 16:4944730-4944752 TGTCCCCTCGGAGCAGGGACAGG - Intronic
1142470985 17:163179-163201 TGACCCTTCATTTGTGGGACTGG - Intronic
1146669091 17:34724528-34724550 TGACTACCCAGAGCTGGGACTGG - Intergenic
1152980793 18:274315-274337 TGAGTCCTCATAGCAGGGACTGG + Intergenic
1154499502 18:14988204-14988226 TGACCCCTGACACCTGGGGCTGG + Intergenic
1157571908 18:48718147-48718169 TGACCACTAATAGCTAGCACAGG - Intronic
1160644121 19:170499-170521 TGACCCCTTTTAGCTGTGGCTGG + Intergenic
1160692883 19:467877-467899 TGACCCCTCCGAGATGGGACTGG - Intronic
1160996403 19:1884084-1884106 AGAGTCCTCAAAGCTGGGACAGG + Intronic
1161364066 19:3868456-3868478 TGACCCCTGATTGCTGGTAGGGG - Intronic
1161769366 19:6223016-6223038 TAACACCTCACAGCTGGGCCTGG + Intronic
1163609515 19:18293622-18293644 TGGCCCCTCATTCTTGGGACGGG + Intergenic
1165843987 19:38806448-38806470 GGACCCCTCACACCTGGGGCCGG + Exonic
1167096567 19:47377753-47377775 GGACTTCTCAGAGCTGGGACAGG + Intronic
1167346029 19:48946331-48946353 TGCCCCCACAGAGCTGGGCCGGG + Intergenic
1167705342 19:51078286-51078308 TGAGACCTCAGAGCTGGGGCAGG - Intronic
1168500270 19:56887248-56887270 TGAACCCTCATAGTTTGGATGGG + Intergenic
933760364 2:85668219-85668241 TGGCCCCTTATAGCTGGGCGGGG + Exonic
935737760 2:106120001-106120023 AGACACCTCACAGCTGAGACAGG - Intronic
938230057 2:129650634-129650656 TGCCCCGTGGTAGCTGGGACCGG - Intergenic
938498708 2:131818572-131818594 TGACCCCTGACACCTGGGGCTGG + Intergenic
940092354 2:149934650-149934672 TGACCTCTGAGAGCTGGGAATGG + Intergenic
941779883 2:169432444-169432466 TGACCCCTGCTGGCTGGGAAGGG + Intergenic
945038738 2:205726804-205726826 TGTCGCCTCAGAGCTAGGACAGG - Intronic
945487887 2:210420012-210420034 TACCCCCTCATAGGTGGGACTGG - Intergenic
1172839056 20:37891074-37891096 TGACCCCAGATTGCTGGGCCTGG - Intergenic
1172904549 20:38359282-38359304 AGAACCCTTATAGCTGGGGCCGG + Intronic
1173168490 20:40703295-40703317 TGGCCCCACAGAGATGGGACTGG + Intergenic
1174778999 20:53371177-53371199 TGACCCCTCCTACCTGTGAATGG - Intronic
1179182905 21:39060997-39061019 TGCCCCGTCAAAGCTGGGATGGG - Intergenic
1180150106 21:45943030-45943052 TGAGCCTGCAGAGCTGGGACAGG - Intergenic
1180499853 22:15921768-15921790 TGACCCCTGACACCTGGGGCTGG + Intergenic
1183172138 22:36196423-36196445 TGACCACTCCCAGCAGGGACTGG + Intronic
950119835 3:10474494-10474516 TGACCTCTAATGGCTGGGGCTGG - Intronic
950480089 3:13238642-13238664 TGACCCCTCCTTGCTGAGCCGGG - Intergenic
952684386 3:36132055-36132077 TGAACCATCAGAGCTGGGAGAGG - Intergenic
952973214 3:38669899-38669921 TGACCCCTGACAGCTGGGAGAGG - Intergenic
960790385 3:121423776-121423798 TGACCACTCAGAACTGGGGCTGG - Exonic
964869848 3:161301783-161301805 TGACCCTTCACAGCTGGGTTAGG - Intergenic
969328545 4:6458843-6458865 TCACCTCTCATTGCTGGGGCTGG + Intronic
971576741 4:28284528-28284550 TTCCCCCTGATAGCTGGAACAGG + Intergenic
971955707 4:33415755-33415777 TGATCTCTCATGGCTAGGACAGG - Intergenic
979036093 4:115720482-115720504 TCTCCCCTCTTAGTTGGGACAGG + Intergenic
982926158 4:161339471-161339493 TGACCCCTCAATGTTGGGAAAGG + Intergenic
983585016 4:169345275-169345297 TGACCCCACACAGCAGGCACAGG + Intergenic
991763222 5:69944303-69944325 TGACCCCTGATAGCTAAAACTGG + Intergenic
991784105 5:70173828-70173850 TGACCCCTGATAGCTAAAACTGG - Intergenic
991842448 5:70819341-70819363 TGACCCCTGATAGCTAAAACTGG + Intergenic
991876552 5:71174212-71174234 TGACCCCTGATAGCTAAAACTGG - Intergenic
995755696 5:115501650-115501672 TGCCCCCACATAGTTGGGTCAGG - Intergenic
998004817 5:138649837-138649859 TGACCCCTCCTAGCTGTCCCCGG - Intronic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998734808 5:145124891-145124913 TGACCCGTCATTCCTGGGGCTGG - Intergenic
1002732800 5:181354282-181354304 TGACCCCTTTTAGCTGTGGCTGG - Intergenic
1002751737 6:119824-119846 TGACCCCTTTTAGCTGTGGCTGG + Intergenic
1003311147 6:4970960-4970982 TGACCCCTCCTCGCTGTGCCTGG - Intergenic
1008482442 6:51999952-51999974 AGACCCTTCATACCTGGGAAAGG + Intronic
1009004791 6:57771232-57771254 TGACCCCTGATAGCTAAAACTGG - Intergenic
1015989536 6:138922682-138922704 TGACCCCTCATAGAAGGAGCTGG - Intronic
1016101158 6:140102054-140102076 CAACACCTCTTAGCTGGGACTGG - Intergenic
1018673880 6:166202380-166202402 CCACGCCTCACAGCTGGGACTGG - Intergenic
1018673886 6:166202406-166202428 CCACGCCTCACAGCTGGGACTGG - Intergenic
1019237056 6:170626600-170626622 TGACCCCTTTTAGCTGTGGCTGG - Intergenic
1020587974 7:10095581-10095603 ATATCCCTCATAGATGGGACAGG + Intergenic
1021827737 7:24572358-24572380 TGAACCCTCAGACCTGTGACAGG - Intergenic
1022519879 7:30999266-30999288 TGACCCCTAAGACCTGGGTCCGG - Intergenic
1022625600 7:32032802-32032824 TGATCCCGCAGAGCTGGGATGGG - Intronic
1035510715 8:180010-180032 TGACCCCTTTTAGCTGTGGCTGG + Intergenic
1039547710 8:38421641-38421663 TCAGCCCTCAAAGCTGGGGCAGG + Intronic
1047509593 8:125506080-125506102 TGACCTCCCATGGCTGGGTCTGG + Intergenic
1047601397 8:126429468-126429490 TCACCCATCATAGCGGGGCCAGG + Intergenic
1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG + Intronic
1048466156 8:134666132-134666154 TTGCCCCTCCTAGCTAGGACTGG + Intronic
1049829650 8:144692272-144692294 AGACCCCACAGAGCTGGGGCGGG - Intergenic
1055916995 9:81414057-81414079 AGTCCCCTCATATCTGGGAGGGG - Intergenic
1058031990 9:100210084-100210106 TGACCCCTCAAGGCTGGGTTAGG + Intronic
1058323067 9:103658420-103658442 TGACCCCTTTTAGCCAGGACTGG - Intergenic
1060001396 9:119962105-119962127 TGACCCCTCAGAAATGGGTCTGG - Intergenic
1060217139 9:121745222-121745244 TGAGCCCACATACCTGGGAAGGG - Intronic
1062532451 9:137007871-137007893 TGACCACCCAGAGCTGGGCCAGG - Exonic
1062532461 9:137007909-137007931 TGACCACCCAGAGCTGGGCCAGG - Exonic
1062757207 9:138306606-138306628 TGACCCCTTTTAGCTGTGGCTGG - Intergenic
1189136864 X:38559558-38559580 TGACTCCAAATAGCTGGGATTGG + Intronic
1189618153 X:42806657-42806679 TGACCCCTCCTAGCATGGCCAGG + Intergenic
1190066209 X:47243386-47243408 TGACACCTCATAGCTGTGGGGGG - Exonic
1194843598 X:98775974-98775996 TGACCCCTTATAGCTATGGCTGG - Intergenic
1200871940 Y:8111182-8111204 TGACTCCTCACATTTGGGACAGG + Intergenic
1202100759 Y:21305254-21305276 TGACTCCTCACATTTGGGACAGG + Intergenic