ID: 903240317

View in Genome Browser
Species Human (GRCh38)
Location 1:21978383-21978405
Sequence CTGGAAGGGCGAGAGGAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 909
Summary {0: 1, 1: 0, 2: 12, 3: 75, 4: 821}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903240317_903240330 27 Left 903240317 1:21978383-21978405 CCACCTTCCTCTCGCCCTTCCAG 0: 1
1: 0
2: 12
3: 75
4: 821
Right 903240330 1:21978433-21978455 CCCCTACAGCTGGCCCTGGCAGG 0: 2
1: 0
2: 4
3: 26
4: 296
903240317_903240328 23 Left 903240317 1:21978383-21978405 CCACCTTCCTCTCGCCCTTCCAG 0: 1
1: 0
2: 12
3: 75
4: 821
Right 903240328 1:21978429-21978451 CGGTCCCCTACAGCTGGCCCTGG 0: 2
1: 0
2: 0
3: 18
4: 121
903240317_903240326 3 Left 903240317 1:21978383-21978405 CCACCTTCCTCTCGCCCTTCCAG 0: 1
1: 0
2: 12
3: 75
4: 821
Right 903240326 1:21978409-21978431 CGTTGTCAATGGTGAGGATGCGG 0: 1
1: 1
2: 2
3: 7
4: 168
903240317_903240327 17 Left 903240317 1:21978383-21978405 CCACCTTCCTCTCGCCCTTCCAG 0: 1
1: 0
2: 12
3: 75
4: 821
Right 903240327 1:21978423-21978445 AGGATGCGGTCCCCTACAGCTGG 0: 2
1: 0
2: 0
3: 3
4: 64
903240317_903240322 -8 Left 903240317 1:21978383-21978405 CCACCTTCCTCTCGCCCTTCCAG 0: 1
1: 0
2: 12
3: 75
4: 821
Right 903240322 1:21978398-21978420 CCTTCCAGCCGCGTTGTCAATGG 0: 1
1: 0
2: 1
3: 0
4: 45
903240317_903240324 -3 Left 903240317 1:21978383-21978405 CCACCTTCCTCTCGCCCTTCCAG 0: 1
1: 0
2: 12
3: 75
4: 821
Right 903240324 1:21978403-21978425 CAGCCGCGTTGTCAATGGTGAGG 0: 1
1: 1
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903240317 Original CRISPR CTGGAAGGGCGAGAGGAAGG TGG (reversed) Exonic
900384088 1:2401414-2401436 GGGGATGGGAGAGAGGAAGGAGG - Intronic
900491774 1:2952884-2952906 CTGGAAATGGGAGAGGGAGGAGG - Intergenic
900648653 1:3720459-3720481 CTGGAGGGACAAGTGGAAGGGGG - Intronic
900847039 1:5112366-5112388 GAGGAAGAGGGAGAGGAAGGGGG + Intergenic
901078807 1:6572058-6572080 CTGGAAGAGGGAGAGGAATGAGG - Intronic
901145914 1:7064579-7064601 TGGGAAGGAAGAGAGGAAGGTGG + Intronic
901684663 1:10937316-10937338 CTGCTAGGCCGAGAGAAAGGGGG - Intergenic
901714784 1:11144597-11144619 CTGGAAGGGGTAGGGGTAGGTGG + Intronic
902690492 1:18107733-18107755 GAGGGAGGGCGAGAGGAGGGGGG + Exonic
902769366 1:18636769-18636791 GAGGGAGGGAGAGAGGAAGGAGG + Intronic
903012937 1:20343586-20343608 CTGGAAGGGGAAGAGGTGGGCGG - Intronic
903132553 1:21289569-21289591 TTGGGAGGGCAAGAGGAAGAGGG + Intronic
903240317 1:21978383-21978405 CTGGAAGGGCGAGAGGAAGGTGG - Exonic
903244065 1:22003017-22003039 CTGGAAGAGTGAGAGGAAGGTGG - Exonic
903384564 1:22917962-22917984 CTGGATGGGCCAGTGGAACGGGG + Intergenic
903507074 1:23844551-23844573 CTGGAAGGCTGTGAGGTAGGTGG + Intergenic
903743944 1:25574199-25574221 CTGGAGAGGAGGGAGGAAGGAGG + Intergenic
904022526 1:27478530-27478552 CTGGAAGGGGAACTGGAAGGAGG + Intronic
904035673 1:27557274-27557296 CTGGAAGGGCCAAGGGCAGGAGG - Intronic
904044882 1:27603171-27603193 CGGGAAGGGGGAGGGGGAGGTGG - Intronic
904292651 1:29497807-29497829 CTGGGAGGGAGAGAAGGAGGTGG + Intergenic
904389401 1:30171912-30171934 CTGGAAGGGAAAGGGGAAGAAGG + Intergenic
904566756 1:31432944-31432966 CTGCAGGGGAGGGAGGAAGGTGG - Intronic
904586083 1:31581388-31581410 GTGGAGGGGCGAGAGGTAGGTGG + Intronic
904687885 1:32273995-32274017 CTGGCAGAGGGAGAGGGAGGGGG + Intronic
904701895 1:32362668-32362690 CTGAGAGGGTGATAGGAAGGCGG + Exonic
905878541 1:41448808-41448830 CTGGAAGGCAGAGAGCTAGGGGG + Intergenic
905969110 1:42127455-42127477 CGGGAAGGGGGAGAGGAACGTGG + Intergenic
906219913 1:44070342-44070364 TCGGAAGGGCGAGAGGGTGGAGG - Intergenic
906312109 1:44761362-44761384 TTGGGAGGCCGAGAGGCAGGTGG + Intronic
906376333 1:45299653-45299675 GTGGAAGGGGTTGAGGAAGGGGG - Intronic
906799081 1:48720325-48720347 CTGGAAGGAGGAGAAGAAGCAGG + Intronic
906937020 1:50223389-50223411 TTGGAGGGGGGAGTGGAAGGAGG - Intergenic
907160123 1:52363596-52363618 CTGGAAGGAGGGGAGGAAGGGGG - Intronic
907381193 1:54091716-54091738 CTGGAAGGGAGAAAGTAAAGGGG - Intronic
907580776 1:55570632-55570654 CTGGAAGGGAAAGAGGAAAAAGG + Intergenic
908111551 1:60903579-60903601 CTGGGAGGGCTAGAGGCAGCTGG - Intronic
908201092 1:61796787-61796809 AAGGAAGGAAGAGAGGAAGGGGG - Intronic
908850049 1:68366714-68366736 CTGGAAGGGTGAGGAGAAAGAGG + Intergenic
911051778 1:93677502-93677524 CTGGAGGGGAGAGAAAAAGGAGG + Intronic
911053931 1:93695031-93695053 GTGGGAGGGCGAGGGGAATGTGG - Intronic
911741636 1:101392563-101392585 CGGGGAGGGCAAGAGGAAGGAGG - Intergenic
912283850 1:108347211-108347233 CAGGAAAAGGGAGAGGAAGGGGG - Intergenic
912665582 1:111576631-111576653 CTGGAAGGGTGAGGGGAGGGAGG + Intronic
912797550 1:112701988-112702010 CTGGAAGAGAGTGAGGATGGAGG - Intronic
913063849 1:115231924-115231946 GGGGAAGGGAGAGAGAAAGGAGG - Intergenic
914048328 1:144108514-144108536 CCCGGAGAGCGAGAGGAAGGAGG + Intergenic
914130856 1:144856934-144856956 CCCGGAGAGCGAGAGGAAGGAGG - Intergenic
914817105 1:151071134-151071156 CTGGAAGGAGGTGAAGAAGGGGG + Intronic
915160704 1:153918107-153918129 CTGGAATGGAGAGAGCAAGAGGG + Intronic
915342834 1:155185618-155185640 CTGGCAGCACAAGAGGAAGGAGG - Intronic
915479151 1:156173360-156173382 TGTGAAGGGAGAGAGGAAGGAGG + Intronic
916078614 1:161218105-161218127 CTGGAAGGGGAAGTGGGAGGAGG + Intronic
916200107 1:162263340-162263362 ATGGAAGGGCAAGAGAGAGGGGG + Intronic
916644033 1:166764363-166764385 TTGGTAGGGCGAGAGGAAGGAGG + Intergenic
917155504 1:171994226-171994248 CTGGAAGGGAGAGAGGAATCTGG - Intronic
918051442 1:180976378-180976400 CTGGAAGGGCCAGTGGGAAGAGG - Exonic
918532228 1:185536682-185536704 AAGGAAGGGAGAAAGGAAGGGGG - Intergenic
918876137 1:190046282-190046304 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
919465971 1:197921801-197921823 AAGGAAGGGAGAGAGGGAGGAGG + Intronic
919505916 1:198397488-198397510 ATGGAAGGAGGAAAGGAAGGAGG - Intergenic
919763214 1:201111237-201111259 CTGGAAGGACAAGAGAAACGTGG - Intronic
919824787 1:201495743-201495765 CTGCAAGGGGCTGAGGAAGGAGG + Intronic
919890404 1:201968797-201968819 CTGGAAGGAAGAGAGAAAGAGGG - Intronic
920748712 1:208653688-208653710 ATGGAGGGGGAAGAGGAAGGAGG - Intergenic
920851697 1:209632547-209632569 GTGGGAAGGGGAGAGGAAGGGGG - Intronic
921047992 1:211490948-211490970 CTGCAAGGGCGAGAGGAATGTGG + Intronic
921465223 1:215478693-215478715 GTGGAAGGGGAAGAGGAAGAAGG + Intergenic
922820548 1:228482402-228482424 CTGGAGGGTAGAGAGGAGGGAGG + Intergenic
923126826 1:231040417-231040439 CTGGAGGGGCGCGAGGGAGGAGG - Intergenic
923233375 1:232009671-232009693 GGGGAAGGGAGAGAGGAAAGAGG - Intronic
923478563 1:234360412-234360434 CTTGAAGTGGGAGAGGAAGTAGG - Intergenic
924479616 1:244416561-244416583 TTGGGAGGCCGAGAGGCAGGAGG - Intronic
924541671 1:244986406-244986428 CTGGAATGGAGACATGAAGGTGG + Intronic
924585919 1:245361194-245361216 CTGGGAGGGCCAAAGGCAGGTGG - Intronic
1062812590 10:477605-477627 GTGGATGGGTGGGAGGAAGGTGG + Intronic
1062972571 10:1660142-1660164 CTGGAAGGGGGCGATGGAGGAGG - Intronic
1063264867 10:4436410-4436432 CAGGGAGGGTCAGAGGAAGGAGG - Intergenic
1063581713 10:7313959-7313981 TTGAAGGGGGGAGAGGAAGGAGG + Intronic
1063699468 10:8370587-8370609 CTGCAAGGGCAAGTGGAAGATGG + Intergenic
1064105558 10:12498184-12498206 CAGGAAGGGCGGGAGAAAAGAGG + Intronic
1064652066 10:17519533-17519555 ATGCAAAGGAGAGAGGAAGGGGG + Intergenic
1064769750 10:18711358-18711380 GGGGGAGGGGGAGAGGAAGGGGG - Intergenic
1064779838 10:18822926-18822948 CATGAAAGGCCAGAGGAAGGAGG + Intergenic
1065177634 10:23095265-23095287 AGGGAAGGGAGAGAGGAAGGGGG + Intergenic
1065177639 10:23095277-23095299 GAGGAAGGGGGAGAGGAAGGGGG + Intergenic
1065284061 10:24170282-24170304 CTGAAAGGAGGAGAGGAAGGTGG + Intronic
1065390005 10:25174067-25174089 GTGTAAGGGAGAGAGCAAGGGGG - Intergenic
1065696945 10:28388668-28388690 CTGGAAGGGGAAGGGGAGGGTGG - Intergenic
1065840996 10:29700972-29700994 CTGGAGCGTGGAGAGGAAGGTGG - Intronic
1066190009 10:33047482-33047504 ATGGAAGGGAGAGAAGAGGGTGG + Intergenic
1066490846 10:35893214-35893236 CAGGGAGTGGGAGAGGAAGGTGG - Intergenic
1067027173 10:42853881-42853903 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1067352635 10:45490489-45490511 CTGGAAGTCCAAGATGAAGGTGG - Intronic
1067777400 10:49173544-49173566 CTGGACTGACGAGAGCAAGGGGG - Intronic
1068521896 10:58085969-58085991 GTGGAAGGTCAAAAGGAAGGAGG - Intergenic
1069676882 10:70254971-70254993 CTGGAATGGTGAGGGGCAGGTGG + Exonic
1070634057 10:78109577-78109599 CTGGAAGGCAGGGAGGCAGGGGG + Intergenic
1070741459 10:78906023-78906045 GTGGAATGGCGAGCGGCAGGAGG + Intergenic
1070774287 10:79100770-79100792 CTGGTAGGGGGTGAGGATGGTGG + Intronic
1071499586 10:86193833-86193855 GTGGAAGGGAGGGAGGGAGGTGG - Intronic
1071527981 10:86369024-86369046 CTGGAAGCTGGAGAGGAAGGAGG - Intergenic
1072811705 10:98467496-98467518 AGGGAAGGGGGAGAGAAAGGAGG + Intronic
1073310274 10:102535165-102535187 GAGGAAGGGGAAGAGGAAGGGGG + Intronic
1073341573 10:102748807-102748829 CTGCTAGGGCAAGAGGAAGATGG + Intronic
1073592129 10:104767628-104767650 GTGGAAGTGGGAGGGGAAGGGGG - Intronic
1073770670 10:106731905-106731927 CAGGGAGGACAAGAGGAAGGAGG + Intronic
1074121870 10:110498933-110498955 CTGGCTAGGCGGGAGGAAGGGGG - Intronic
1074423259 10:113328061-113328083 CCATAAGGGGGAGAGGAAGGTGG - Intergenic
1074853516 10:117457065-117457087 CAGGAAGGACCAGAGGAAAGGGG + Intergenic
1074969650 10:118525627-118525649 GAGGAAGAGAGAGAGGAAGGAGG - Intergenic
1075114012 10:119610874-119610896 CTGCAATGGGGACAGGAAGGAGG + Intergenic
1075129423 10:119725844-119725866 GCGGAAGGACGAGAGGGAGGAGG + Intergenic
1075288437 10:121207450-121207472 CTGGAAGGGAAAGATGAATGGGG - Intergenic
1075566717 10:123510397-123510419 TTGGAAGGAGGAGAGGAAGGCGG - Intergenic
1076083980 10:127608758-127608780 CTGAAAGGTGGGGAGGAAGGCGG - Intergenic
1076108139 10:127840796-127840818 CAGGATGAGCGGGAGGAAGGTGG + Intergenic
1076329141 10:129652271-129652293 CTGCTGGGGCCAGAGGAAGGAGG - Intronic
1077522697 11:3045697-3045719 GTGGAAGGGCGAGCAGGAGGAGG + Intronic
1077709716 11:4523574-4523596 TTGGAAAGGGGAGAGAAAGGTGG + Intergenic
1077783200 11:5354617-5354639 GTGGAGGGGCGGGAGGAAGTGGG - Intronic
1077985578 11:7347992-7348014 CTGGAGGAGTGAGGGGAAGGGGG + Intronic
1078390473 11:10931761-10931783 CCCGGAGGGAGAGAGGAAGGCGG + Intergenic
1079132558 11:17756026-17756048 CAGGAAGTGCAAGAAGAAGGAGG + Intronic
1079361013 11:19770387-19770409 CTGGGAGGGTGGGAGGAGGGAGG + Intronic
1079683503 11:23326969-23326991 GTGGAGGGGGGAGAGGGAGGGGG + Intergenic
1081207528 11:40293103-40293125 TTGGAGGGGAGAGGGGAAGGTGG - Exonic
1081336431 11:41872655-41872677 CTGGTAGGCGGAGAGGAAGCAGG - Intergenic
1081395911 11:42586061-42586083 GTGGAAGGCAAAGAGGAAGGAGG + Intergenic
1082105615 11:48218132-48218154 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1082819845 11:57537502-57537524 GTGGAAGAGGGAGAGGAAGGGGG + Intergenic
1083302195 11:61745121-61745143 CTGGAGGGGCCAGAGGAGGGTGG + Exonic
1083901642 11:65646300-65646322 CTGGAAGTGCGAGCGGATGGTGG - Exonic
1084032484 11:66489106-66489128 CTGGGAGGCCGAGAGGCACGCGG - Intronic
1084450641 11:69234727-69234749 CACGAAGGGCAGGAGGAAGGGGG + Intergenic
1084859529 11:72009220-72009242 GTTGAAGGGCAGGAGGAAGGTGG + Intronic
1084906774 11:72354594-72354616 GTGGGAGGGAGGGAGGAAGGTGG - Intronic
1084964832 11:72739115-72739137 CTGGCAGGGCTGGAGGGAGGTGG - Intronic
1085247047 11:75110278-75110300 CTGTAAGGGAGTGAGGGAGGTGG + Intronic
1085297417 11:75438991-75439013 CTGTAAGTGCCAGAGGCAGGGGG + Intronic
1085533909 11:77206973-77206995 CTGGAAGGGTGATTAGAAGGAGG - Intronic
1085667672 11:78429835-78429857 CTGTAAGGCAGATAGGAAGGAGG + Intergenic
1085728990 11:78980378-78980400 CTGGTAAGGCGAGAGCCAGGAGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1086360811 11:86057295-86057317 TTGGGAGGCCGAGAGGCAGGCGG + Intronic
1086464349 11:87037952-87037974 CTGGCCGGGCGAGAGGCTGGCGG + Intronic
1086953825 11:92915958-92915980 CTGGAAGGTAGAGTGGAAGGAGG + Intergenic
1087169132 11:95032488-95032510 GAGGAAGGGAGAGAGGCAGGGGG + Intergenic
1087188531 11:95229959-95229981 GGGGAAGGGCGAGAGGGATGGGG - Intronic
1088116027 11:106315892-106315914 GAGGAAGGGAGAGAGGAAGGAGG - Intergenic
1088150141 11:106735274-106735296 CTGGAAAGGAGAGAGGAAAATGG - Intronic
1088197676 11:107293863-107293885 CAAGGAGGGCAAGAGGAAGGAGG + Intergenic
1088923004 11:114275286-114275308 CTGGAAGGGAAAGATGATGGAGG + Intronic
1088967584 11:114739340-114739362 GAGGGAGGGAGAGAGGAAGGGGG - Intergenic
1089133638 11:116232105-116232127 CTTGAAGGGCTGGGGGAAGGAGG - Intergenic
1089319310 11:117614046-117614068 CTGGAAAGGTGGGAGGAAAGGGG + Intronic
1089901640 11:121992679-121992701 CTGGCAGTGTGAGAGGATGGAGG - Intergenic
1090023961 11:123151948-123151970 CTGGAGAGGGAAGAGGAAGGAGG - Intronic
1090951953 11:131481454-131481476 CTGGATGGTGGAGAAGAAGGGGG + Intronic
1091335148 11:134761031-134761053 GAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1091702699 12:2674355-2674377 GAGGAAGGGGAAGAGGAAGGAGG + Intronic
1091745450 12:2989181-2989203 TTGGGAGGCCGAGAGGCAGGAGG - Intronic
1091889886 12:4045041-4045063 CTGGAAGACCAGGAGGAAGGGGG + Intergenic
1091989192 12:4940945-4940967 ATGGAAGCTGGAGAGGAAGGTGG + Intergenic
1092045525 12:5430026-5430048 CTGGAGGGAGGAGGGGAAGGGGG - Intergenic
1092088618 12:5786022-5786044 CAGGAAGGGGGAGAGGCTGGGGG + Intronic
1092131959 12:6119034-6119056 CTGAAAAGGAGAGAGGTAGGAGG - Intronic
1092169382 12:6363711-6363733 CTGAAGGGGCGAGGGGAAGAGGG + Intronic
1092218721 12:6699317-6699339 CGGGAAGGGCGTGGGGAAGCAGG + Intronic
1092370876 12:7915906-7915928 GGGGAAGGGGGAGGGGAAGGGGG - Intergenic
1092456455 12:8648041-8648063 ATGTATGGGTGAGAGGAAGGAGG - Exonic
1092747847 12:11690267-11690289 TTGTAAGGACGTGAGGAAGGGGG - Intronic
1093097278 12:14985653-14985675 CAGGGAGGGTGAGAGGCAGGTGG + Intergenic
1093507539 12:19885952-19885974 AGAGAAGGGCAAGAGGAAGGGGG - Intergenic
1093662612 12:21774731-21774753 CAGGGAGGGCTAGAGGAAGGGGG + Exonic
1093669990 12:21862386-21862408 GTGGAGAGGCAAGAGGAAGGGGG - Intronic
1094107172 12:26826457-26826479 CTGGTAGGGTGATAGGGAGGGGG - Intronic
1095174715 12:39078317-39078339 AAGGAAGGGAGAAAGGAAGGAGG + Intergenic
1095913582 12:47453817-47453839 ATGGAAGGGACAGAGGAGGGAGG - Intergenic
1096468655 12:51863255-51863277 CTGGAAGGGAGGGAGGGAAGGGG - Intergenic
1096476206 12:51910786-51910808 CGGGAGGGGCAAGAGGCAGGAGG + Intronic
1096493084 12:52023568-52023590 CTGGGAGCGCGAGATGGAGGCGG - Intronic
1096709211 12:53443195-53443217 CTGGAAGGGCTAGGGAGAGGAGG - Intronic
1096774759 12:53957084-53957106 CTGGTAGGGCTGGAGGAAGTGGG + Exonic
1096786817 12:54021649-54021671 CTTGAAGGGCGGGAGGAAGGTGG - Intronic
1096844133 12:54396135-54396157 CTTGAAGGGCCAGAGCCAGGGGG - Exonic
1096961382 12:55581629-55581651 CTGGAGGGTGGAGAGGGAGGAGG - Intergenic
1097113016 12:56676125-56676147 CTGGGAGGGGGAGGGGGAGGGGG + Intronic
1097955557 12:65482029-65482051 GAGGAAGGAGGAGAGGAAGGAGG - Intronic
1098614539 12:72507061-72507083 GTGGAAGGCAAAGAGGAAGGAGG - Intronic
1099487651 12:83248404-83248426 GTGGAAGGAGAAGAGGAAGGAGG - Intergenic
1099957396 12:89364011-89364033 CTGGAAGGGAGAGAGAAACTGGG + Intergenic
1099970228 12:89492758-89492780 CTGGATGTGGGAGAGGAAGCAGG - Intronic
1100214405 12:92432961-92432983 GTGGAAGGCAAAGAGGAAGGAGG + Intergenic
1100550743 12:95644403-95644425 AAGGAAGGGGGAGAAGAAGGGGG - Intergenic
1100738568 12:97565558-97565580 GTGAGAGGGAGAGAGGAAGGGGG + Intergenic
1102128464 12:110504894-110504916 TTGGAAGGCTGAGAGGAGGGAGG + Intronic
1102228065 12:111243229-111243251 CTAGAGGTGTGAGAGGAAGGTGG - Intronic
1102236302 12:111296621-111296643 CTGGGAGGGTCAGAGGGAGGAGG - Intronic
1102236326 12:111296705-111296727 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102236351 12:111296789-111296811 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102236376 12:111296873-111296895 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102236421 12:111297037-111297059 CTGGAAGGGTCAGAGGGAGGAGG - Intronic
1102236434 12:111297093-111297115 CTGGGAGGGTCAGAGGGAGGAGG - Intronic
1102236443 12:111297121-111297143 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1103005631 12:117418092-117418114 AGGGAAGGTAGAGAGGAAGGAGG + Intronic
1103045217 12:117730486-117730508 GTGGAAGGGGGAGAGGGAGAGGG - Intronic
1103065566 12:117894701-117894723 CGGGAAGGGGGAGAGGGAGATGG - Intronic
1103173613 12:118843509-118843531 CTGGAAGGGCCTGAGGCAGCAGG - Intergenic
1103366779 12:120389607-120389629 AAGGAAGGAAGAGAGGAAGGAGG + Intergenic
1103366798 12:120389664-120389686 TAGGAAGGGAGAGAGGAAGGAGG + Intergenic
1103366812 12:120389708-120389730 AAGGAAGGGAGAGAGGAAGGAGG + Intergenic
1103527861 12:121579551-121579573 TTGGAAGGGGGAGAGGCAGACGG + Intronic
1103564900 12:121810620-121810642 CTGGAGGGGCGTGACGAGGGGGG - Exonic
1103613742 12:122139418-122139440 CTGGAAGGCTGAGTGCAAGGTGG - Intronic
1103937846 12:124485972-124485994 GTGGTAGGGTGAGAGGGAGGTGG - Intronic
1104091467 12:125521300-125521322 GGGGAAGGGGAAGAGGAAGGAGG - Intronic
1104292521 12:127483208-127483230 CCCGAAGGGCGAGAGAAGGGGGG + Intergenic
1104325023 12:127787484-127787506 CTGGAAGGGCGAGAAGGTGGAGG - Intergenic
1104463381 12:128971871-128971893 CAGAAAGGGAGAGAGGAGGGAGG - Intronic
1104616956 12:130278577-130278599 ATGGAAGGGAGAGAGCAGGGAGG + Intergenic
1104923373 12:132302895-132302917 CTGAGAGGGAGAGAGGAGGGTGG + Intronic
1105764591 13:23546922-23546944 ATGGAGGGGAGAGAGGAGGGAGG - Intergenic
1106227964 13:27799289-27799311 CTGGAATGGCAAGAGTAGGGGGG + Intergenic
1106552892 13:30787087-30787109 CTGGCAGGGGGAGAGGTTGGTGG + Intergenic
1107809342 13:44185084-44185106 CTGGAAAGGGGAGAGGAAAGGGG + Intergenic
1107881572 13:44836808-44836830 ATGGGAGGGAGAGAGGCAGGAGG - Intergenic
1107888798 13:44896290-44896312 TTGGGAGGGCGGGAGGAAGGAGG - Intergenic
1110125996 13:71942804-71942826 ATGGAAGGAGAAGAGGAAGGAGG - Intergenic
1110137758 13:72089398-72089420 GTGTAAGGAAGAGAGGAAGGGGG + Intergenic
1110818157 13:79883634-79883656 CACAAAGGGTGAGAGGAAGGGGG + Intergenic
1111084134 13:83351805-83351827 GAGGAAGGGAGAAAGGAAGGGGG + Intergenic
1111293489 13:86198935-86198957 CTGGAAGTCCGAGATTAAGGTGG - Intergenic
1111331652 13:86765797-86765819 CTGGAAGGGTCATTGGAAGGGGG + Intergenic
1111483873 13:88869232-88869254 GTGGGAGGCCAAGAGGAAGGAGG - Intergenic
1112429971 13:99342735-99342757 CTGGAAGGGAGGGAACAAGGAGG - Intronic
1112734642 13:102402333-102402355 CTGGAAGAGTGAGAGGAAGGAGG - Intergenic
1112760297 13:102687880-102687902 GTGGAAAGGTTAGAGGAAGGTGG - Intronic
1113278375 13:108760738-108760760 TGGGAAGGGGAAGAGGAAGGAGG + Intronic
1113319114 13:109214839-109214861 GTGGAAGGTGAAGAGGAAGGGGG + Intergenic
1113326643 13:109288794-109288816 GAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1113417466 13:110139226-110139248 TTGGAAGTGGGAGAAGAAGGAGG + Intergenic
1113485494 13:110649660-110649682 CAAGAAGGGGGAGAGGGAGGTGG + Intronic
1113576790 13:111400513-111400535 CTGGTAGAGAGAGAGGAGGGAGG - Intergenic
1115006881 14:28496609-28496631 GAGGAAGGGAGAGAGGAAGGAGG - Intergenic
1115369866 14:32601034-32601056 CTTTAAGGGTGAGAGAAAGGGGG + Intronic
1115419792 14:33181250-33181272 GTGGAAGGAAAAGAGGAAGGAGG + Intronic
1115548934 14:34488005-34488027 CTGGAAGGGCAAGAGGAGACAGG - Intergenic
1115875596 14:37858028-37858050 GAGGAAGGGAGGGAGGAAGGAGG - Intronic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1116397070 14:44459182-44459204 GTGGAAGGTGGAGAGGAAGCAGG - Intergenic
1116495473 14:45554763-45554785 GTGGAAGGTGAAGAGGAAGGGGG + Intergenic
1116625554 14:47258343-47258365 GTGGAAGGCGGAGAGGAAGGAGG + Intronic
1116786205 14:49291489-49291511 AGGGAAGGGAGGGAGGAAGGAGG + Intergenic
1117749720 14:58908621-58908643 TTGGAAGGGTGAGGGGATGGAGG + Intergenic
1118313530 14:64709599-64709621 CTGGAAGGGAAAGATGCAGGAGG + Intronic
1118660638 14:68005965-68005987 GAGGAAGAGAGAGAGGAAGGAGG + Intronic
1118681879 14:68250199-68250221 CTGGTAGGGAGACAGGAAGAAGG - Intronic
1119219531 14:72894658-72894680 CAAGAAGCGAGAGAGGAAGGTGG - Intergenic
1119456471 14:74760330-74760352 GAGGAAGGGAGAGAGGAAGGAGG - Intergenic
1119581185 14:75782802-75782824 CTAGAAGGGTGAAAAGAAGGGGG + Intronic
1120047171 14:79820650-79820672 CAGGGAGGGTGAGAGGATGGAGG - Intronic
1120388128 14:83871233-83871255 AAGGAAGGGGGAGAAGAAGGAGG + Intergenic
1120751343 14:88201414-88201436 TTGGGAGGCCGAGAGGTAGGTGG + Intronic
1121083965 14:91131054-91131076 TTGGGAGGGTGAGAGGCAGGAGG - Intronic
1121767830 14:96502657-96502679 CGGGAAGGGGAAGAGGTAGGCGG + Intronic
1121788154 14:96678402-96678424 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
1122039931 14:98979918-98979940 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
1122253899 14:100462950-100462972 GAGCAAGGGGGAGAGGAAGGGGG - Intronic
1122253915 14:100463005-100463027 GAGCAAGGGGGAGAGGAAGGGGG - Intronic
1122375725 14:101255760-101255782 CCTGGGGGGCGAGAGGAAGGTGG - Intergenic
1122692866 14:103539373-103539395 CGGGAGGGGCGAGAGGAGGGCGG - Intergenic
1122948570 14:105027070-105027092 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1123426787 15:20178398-20178420 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1123536019 15:21184925-21184947 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1123839438 15:24232911-24232933 CAGAAAGGGAGAGAGAAAGGTGG + Intergenic
1124614889 15:31234336-31234358 CTGCAAGGGAGGGAGGAAGTGGG + Intergenic
1125106412 15:35976881-35976903 CTGGAAGAGGGAGAGGCTGGTGG - Intergenic
1125386540 15:39142714-39142736 CTGGCAGAGCAGGAGGAAGGAGG - Intergenic
1125743700 15:41984906-41984928 CTGGAAGGGCGACTGGAACCAGG + Intronic
1125851489 15:42907655-42907677 CTGAAAAGGGGAGGGGAAGGGGG + Intronic
1126617077 15:50594958-50594980 TTGGAAGGCCAAGAGGCAGGAGG + Intronic
1126777015 15:52109094-52109116 ATGGAAGGGGGAGAGGAAGGAGG + Intergenic
1127560536 15:60132329-60132351 ATGGAAGGGAGGGAGGGAGGAGG + Intergenic
1127981937 15:64041837-64041859 GTGGAAGGGAGAGAGGCAGGCGG - Intronic
1128148221 15:65344516-65344538 CTGGATGGGGGAGAGGTGGGGGG + Intronic
1128797922 15:70478579-70478601 CAGGCAGGGCGAGTGGGAGGAGG - Intergenic
1128975662 15:72151345-72151367 CTGGAAGAGAGAGAAGAAGAAGG - Intergenic
1129044878 15:72725765-72725787 GAGGAAGGGGAAGAGGAAGGGGG - Intronic
1129085307 15:73083349-73083371 ATGGAAGGGGGAGAGGTAGAGGG + Intronic
1129710917 15:77819876-77819898 CTGGAAGGGGGGGAGAAGGGCGG - Intronic
1129715525 15:77846385-77846407 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
1129795449 15:78372951-78372973 TTGGAAGCCTGAGAGGAAGGGGG - Intergenic
1130359268 15:83166732-83166754 GTGGAAGGTGAAGAGGAAGGAGG + Intronic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1130800938 15:87262552-87262574 CATGAAGGGCGAGATGAAGCAGG - Intergenic
1130856525 15:87843959-87843981 CAGGCAGGATGAGAGGAAGGAGG + Intergenic
1131014160 15:89043533-89043555 GGGGAAGGGAAAGAGGAAGGAGG + Intergenic
1131241411 15:90747007-90747029 CTGGAAGGGAGCGAGGTGGGAGG - Intronic
1131322437 15:91407441-91407463 CTGGAAGGGAAGGAGGAAAGCGG + Intergenic
1131422079 15:92315301-92315323 CTGGAAAGGCAGGAGGGAGGAGG - Intergenic
1131525814 15:93151643-93151665 CTGGAAGGGGAGGAGGAAGGAGG - Intergenic
1131631061 15:94177172-94177194 CTGAAAGGGCGGGAAAAAGGAGG - Intergenic
1131900959 15:97087173-97087195 CTTGAAGGGTGAGAGGATAGAGG - Intergenic
1132571419 16:646016-646038 CTGGAAGTGGGAGAGGTTGGCGG + Intronic
1132599458 16:767468-767490 CTGGTATGGCGAGCGGGAGGAGG + Exonic
1132701848 16:1225342-1225364 CAGGCAGGGCGGGAGGACGGAGG + Intergenic
1132854383 16:2038405-2038427 GGGGAAGGGGGAGGGGAAGGGGG - Exonic
1133839249 16:9394005-9394027 GGGGAAGGGAGACAGGAAGGGGG - Intergenic
1133952218 16:10405410-10405432 CTGGAAGGGGCAGAGCAAGGTGG + Intronic
1134260214 16:12645141-12645163 CAAGAATGGTGAGAGGAAGGGGG - Intergenic
1134429278 16:14186601-14186623 CTGGAATGGCAAGGGAAAGGGGG + Intronic
1134599805 16:15524428-15524450 CTGGGAGGTGGGGAGGAAGGTGG + Intronic
1134770617 16:16806079-16806101 GGGGAAGGGGGAGAGGAAGGGGG - Intergenic
1135166381 16:20142822-20142844 CTGGGAGGGAGCGAGGGAGGTGG + Intergenic
1135640915 16:24119217-24119239 CTGGGAGGGAGGGAGGAAAGAGG + Intronic
1135770446 16:25214341-25214363 AAGGAAGGGAGAAAGGAAGGAGG - Intergenic
1136080983 16:27852520-27852542 GTGGAAGGGTCAGAGGGAGGAGG + Intronic
1136857456 16:33671100-33671122 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1136985802 16:35103113-35103135 CTGGAAGGGAGATAGAAAGGAGG - Intergenic
1137242893 16:46673417-46673439 CTGGAAGGGAGATAGAAAGGAGG + Intronic
1137684286 16:50374934-50374956 CTGGAAGGGCTGGGGGAGGGTGG + Intergenic
1138506257 16:57479804-57479826 GAAGAAGGGCGGGAGGAAGGAGG - Intronic
1138856095 16:60694671-60694693 GTGCAGGGGTGAGAGGAAGGTGG + Intergenic
1139319989 16:66106567-66106589 CTGGGAGGGTGAGAGGCAGGAGG + Intergenic
1139504977 16:67394190-67394212 CTGGGAGGCCGAGAGAAAGCAGG - Intergenic
1139650901 16:68361590-68361612 CTGGAAGGCCGTGAGTCAGGAGG - Exonic
1140270167 16:73458365-73458387 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1140337702 16:74125008-74125030 GTGGAAGGGGGAGAGGAGAGAGG - Intergenic
1140416076 16:74774711-74774733 CTCGGAGGGCGAGAAGGAGGCGG + Exonic
1140456542 16:75109075-75109097 CAGGCAGGGCGAGTGGAACGTGG - Exonic
1140609574 16:76581828-76581850 GTGGAAGCGCAAGAGGAAGCAGG - Intronic
1140878310 16:79173859-79173881 ATGGATGGGGGAGAGGACGGTGG + Intronic
1140999489 16:80295159-80295181 CAGTCAGGGAGAGAGGAAGGAGG - Intergenic
1141164320 16:81650371-81650393 CTGGAAGGAGGAAAGAAAGGTGG + Intronic
1141286857 16:82680786-82680808 CTGAAAGGGCAAGGAGAAGGGGG + Intronic
1141693915 16:85611312-85611334 CTGGGAGGGGGAGGGGGAGGGGG - Intergenic
1141856258 16:86683222-86683244 GAGGGAGGGAGAGAGGAAGGAGG + Intergenic
1141887715 16:86904061-86904083 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
1141968186 16:87461262-87461284 CCAGAGGGGCGAGAGGAGGGGGG + Intronic
1142071321 16:88092481-88092503 AAAGAAGGGAGAGAGGAAGGAGG + Intronic
1142113791 16:88345951-88345973 CTGGAAGGACCAGAGGAAAATGG + Intergenic
1142264490 16:89057525-89057547 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142264518 16:89057615-89057637 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142596825 17:1033841-1033863 CTGGAAGGGGCAGGCGAAGGAGG - Intronic
1142659280 17:1416555-1416577 CTGGAAGGCTGAGAGGTGGGAGG + Intergenic
1142785772 17:2221386-2221408 GTGGAAGGCAAAGAGGAAGGAGG - Intronic
1143007312 17:3845708-3845730 CTGGAAGGATGAGATAAAGGGGG - Intronic
1143150131 17:4802454-4802476 ATGGAAAGGGGAGAGGAGGGAGG + Intergenic
1143374465 17:6459059-6459081 GTGGAAGGGCCAGACGAAGAGGG - Intronic
1144016895 17:11204690-11204712 CTGGAATGTGGAGAGGAATGAGG + Intergenic
1144058561 17:11561607-11561629 CTGGGAGGGAGAGTGGAAAGAGG - Exonic
1144504845 17:15821270-15821292 CGGGCAGGTGGAGAGGAAGGAGG - Intergenic
1144995381 17:19264708-19264730 GAGGAAGGGAGAGAGAAAGGGGG + Intronic
1145169018 17:20639153-20639175 CGGGCAGGTGGAGAGGAAGGAGG - Intergenic
1145203581 17:20968592-20968614 CGGGCAGGTGGAGAGGAAGGAGG - Intergenic
1145253338 17:21308800-21308822 CTGGAAGGGAGACAGGGAGATGG - Intronic
1145779288 17:27551761-27551783 CAGGGAGGGAGAGAGGCAGGCGG - Intronic
1146287746 17:31585610-31585632 CAGGAAGGGAGAGAGAAAGAAGG - Intergenic
1146692791 17:34888218-34888240 CTGGAAGGACCAGATTAAGGTGG - Intergenic
1146918359 17:36692607-36692629 GGGGAAGGGTGGGAGGAAGGAGG - Intergenic
1147178819 17:38672757-38672779 CTAGAAAGGGGACAGGAAGGGGG + Exonic
1147185186 17:38709410-38709432 CCAGGAGGGTGAGAGGAAGGTGG + Intronic
1147216245 17:38900820-38900842 CTGGAAGTTGGAGGGGAAGGAGG - Intronic
1147360217 17:39925547-39925569 CTGCAGGGGCGTGAGGGAGGTGG - Intronic
1147462254 17:40580688-40580710 TTGGAAGGCTGAGAGGCAGGAGG + Intergenic
1147530194 17:41269070-41269092 ATGGAAGGAAGAAAGGAAGGAGG + Intergenic
1148033129 17:44636288-44636310 CTGGAAGGGGGTGGGGAAGATGG + Intergenic
1148324780 17:46776905-46776927 CTGGGAGAGGGGGAGGAAGGAGG - Intronic
1148465630 17:47863480-47863502 AAGGAAGGGAGGGAGGAAGGGGG + Intergenic
1148466262 17:47866892-47866914 CTGGGAGGGAGACAGGGAGGGGG + Intergenic
1149441004 17:56673889-56673911 CTGGAAGGGAGTGAGGGAGAGGG - Intergenic
1150489836 17:65566658-65566680 CTGCAAAGGGGAGAGGAAGTAGG - Intronic
1150968805 17:70003190-70003212 TTGGGAGGCCGAGAGGCAGGAGG - Intergenic
1151249948 17:72826280-72826302 GTGGAAGGTGAAGAGGAAGGAGG - Intronic
1151405724 17:73884918-73884940 CTGGAAGGCAGAGGGTAAGGGGG + Intergenic
1151484540 17:74390177-74390199 AAGGAAGGGGGAGAGGAAGAGGG - Intergenic
1151486385 17:74403689-74403711 CTGGGAGGCTCAGAGGAAGGAGG - Intergenic
1151560728 17:74868149-74868171 CTGGGATGGAGAGAGGCAGGAGG - Intronic
1151582652 17:74988849-74988871 CAGAAAGGGCGACTGGAAGGGGG + Intronic
1151822114 17:76502021-76502043 CTGGAAGGGCCAGAGCTGGGTGG - Intergenic
1152003575 17:77662697-77662719 CTGGAAGTTCAAGATGAAGGTGG - Intergenic
1152187108 17:78864373-78864395 AAGGAAGGGAGGGAGGAAGGGGG - Intronic
1152229419 17:79107030-79107052 CTGGGATGGCGGGAGGGAGGCGG - Intronic
1152375293 17:79915717-79915739 CTGGAGGGTCGAGGGGCAGGTGG + Intergenic
1152898381 17:82926256-82926278 ATGGATGGCCGTGAGGAAGGTGG + Intronic
1153416385 18:4850418-4850440 CTGAGGGGGTGAGAGGAAGGTGG - Intergenic
1153958630 18:10121255-10121277 GCAGAAGGGCGAGTGGAAGGTGG + Intergenic
1155723857 18:29054273-29054295 CTGCAAGAGGGAGAGCAAGGGGG + Intergenic
1156349528 18:36291455-36291477 CTAAAAGGGGAAGAGGAAGGAGG - Intergenic
1156710263 18:39935793-39935815 CTGGAAGGCCAAGAGGAAGGAGG + Intergenic
1156740538 18:40322073-40322095 GTGGAAGGGGAAGAGGAAGGAGG - Intergenic
1158418938 18:57275521-57275543 CTGGAAGGACTGGAGGAGGGAGG - Intergenic
1158555345 18:58470366-58470388 CTGGGAGGGAGAGAGGAGGAAGG + Intergenic
1158610513 18:58935501-58935523 CTCGAAGGGGGAGAGGGAGGAGG - Intronic
1158931482 18:62328200-62328222 GAGGAAGGGAGAGAGGGAGGAGG + Intronic
1159478833 18:68960399-68960421 CTGAAAAGGGGAGAGGAAAGAGG - Intronic
1159942167 18:74416627-74416649 AAGGAAGGTCGAAAGGAAGGGGG - Intergenic
1160123928 18:76153598-76153620 CTGGCAGAGAGAGAGGCAGGTGG + Intergenic
1160244509 18:77146333-77146355 CTTGAAGGGAAAGAGGAAAGTGG + Intergenic
1160918389 19:1508305-1508327 CTGGAAGGGGAGGGGGAAGGCGG + Intronic
1161025632 19:2035433-2035455 CTGGAGGCGGGAGCGGAAGGAGG - Intergenic
1161093923 19:2377660-2377682 AAGGAAGGGAGAGAGGGAGGGGG - Intergenic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1161779287 19:6280144-6280166 CCGGAGGGGCGGGAGGAGGGAGG + Intergenic
1161868949 19:6855743-6855765 TTGGAAGGGTGAGTGGATGGTGG - Intronic
1162561699 19:11421224-11421246 TGGGAAGCGAGAGAGGAAGGTGG + Intronic
1162760738 19:12886878-12886900 CTGGCAGGGGGTGAGGAGGGTGG - Intronic
1162954705 19:14091356-14091378 CTGGCAGGGGGAGTAGAAGGGGG - Intergenic
1163235403 19:16026888-16026910 CTGGCAGTGGGAGAGGCAGGAGG + Intergenic
1163276317 19:16286537-16286559 CTTGAGGGGAGAGAGGATGGCGG + Intergenic
1163769192 19:19180441-19180463 CTGGAAAAGAGAGAGGAAGGTGG + Intronic
1163783569 19:19262843-19262865 CTGCAAGGGGAGGAGGAAGGCGG + Intergenic
1163820291 19:19492558-19492580 CTGCAGGGGCGAGAGGAACAGGG - Intronic
1163860016 19:19737952-19737974 CTGGAAGGCCCAGCAGAAGGGGG + Intergenic
1164569675 19:29364092-29364114 AGGGAAGGAAGAGAGGAAGGAGG + Intergenic
1165135071 19:33662659-33662681 GTGGAGGGGCAGGAGGAAGGAGG + Intronic
1165342029 19:35219517-35219539 TTGGAAGGGAGAGAGCCAGGGGG + Intergenic
1165646338 19:37441412-37441434 TTGGGAGGCCGAGAGGCAGGAGG + Intronic
1165803838 19:38568403-38568425 CTGGAGGGGAGACAGGATGGAGG - Intronic
1165862636 19:38917338-38917360 CTGACAGGGTGAGAGGAAGTGGG + Intronic
1165893564 19:39128717-39128739 CTGGAAGGGAGGGAGGAGGGGGG - Intronic
1165952802 19:39483528-39483550 CAGAAGGGGAGAGAGGAAGGCGG - Intronic
1166513287 19:43425672-43425694 AAGGAAGGGAGAGAGGGAGGGGG + Intergenic
1166692758 19:44833562-44833584 GAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1166992153 19:46699082-46699104 CAGGGAGGGCGAGGGGAAGAGGG - Intronic
1166997684 19:46727568-46727590 CTGGTAGGGGGAGGGGAGGGAGG + Intronic
1167229087 19:48270464-48270486 CAGAGAGGGAGAGAGGAAGGGGG + Intronic
1167272241 19:48511922-48511944 CAGGAAGGGTGGGAGGAGGGAGG + Intronic
1167279996 19:48561503-48561525 CTGGAAGGGAGAGAGAGAGGAGG + Intronic
1167295298 19:48646034-48646056 CTGGAAAGGAGAGAGGGAGGAGG - Exonic
1167384339 19:49155365-49155387 CAGCAAGGACCAGAGGAAGGTGG - Exonic
1167556219 19:50197603-50197625 CTGGAATGGAATGAGGAAGGAGG + Intronic
1167607305 19:50488335-50488357 CAGGAGGGGAGAGAGGAAGAGGG + Exonic
1167676498 19:50889679-50889701 ATGGAAGGGTGGGAGGTAGGAGG - Intergenic
1168036420 19:53723180-53723202 CTGGGAGGGGCAGAGGCAGGAGG - Intergenic
1168097603 19:54124471-54124493 GTGGGAGGGAGGGAGGAAGGGGG - Intronic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
1168154440 19:54465074-54465096 CGGGAAGGGCGCGGGGAATGAGG + Exonic
1168317030 19:55488983-55489005 CTGGAAGGGAGGGCGGAGGGTGG - Intronic
1168317677 19:55491125-55491147 CTGGAGGGGCAAGAGGGAGCTGG - Intronic
1168406040 19:56111243-56111265 CTGGAATGGCGCCAGGAGGGAGG + Intronic
1168443269 19:56390189-56390211 CAGGAAGTGCCAGAGGAAGATGG + Intronic
1202687780 1_KI270712v1_random:61409-61431 CCCGGAGAGCGAGAGGAAGGAGG + Intergenic
925068647 2:950175-950197 CGGGAAGGGAGGGTGGAAGGAGG + Intergenic
925369106 2:3330382-3330404 ATGGAAGGTCCAGAGCAAGGGGG + Intronic
925428231 2:3769134-3769156 CAGGAAGGGCGAGAGGGAAACGG + Intronic
925506126 2:4567325-4567347 CTGGGAAGGGTAGAGGAAGGGGG - Intergenic
925637677 2:5957269-5957291 ATGGAAGGCAAAGAGGAAGGAGG + Intergenic
925710163 2:6731411-6731433 CAGGAGGGGCCAGAGGAAGAGGG + Intergenic
925742725 2:7019974-7019996 CTAGAAGACCGAGAGGAAGAGGG - Intronic
925893848 2:8456813-8456835 CTGGAAGGGCCAGCGTCAGGGGG + Intergenic
925927589 2:8681676-8681698 GGGGAAGGGGGAGGGGAAGGAGG - Intronic
925927594 2:8681688-8681710 GGGGAAGGGGGAGGGGAAGGGGG - Intronic
926088298 2:10033597-10033619 CTGAAAGGGAGATAGCAAGGCGG + Intergenic
926217694 2:10915438-10915460 CTAGATGGGGGAGAGGGAGGTGG + Intergenic
926663163 2:15491169-15491191 GAGGAAGGGTGGGAGGAAGGTGG - Intronic
926884182 2:17582217-17582239 CAGGAGGGGTGAGGGGAAGGAGG + Intronic
927254422 2:21027655-21027677 CTAGCGGGGAGAGAGGAAGGCGG + Intronic
927352481 2:22133678-22133700 CTGGGAAGACAAGAGGAAGGAGG - Intergenic
927487159 2:23496476-23496498 CAGGATGGGGGAGAGGGAGGAGG - Intronic
928201020 2:29247543-29247565 CAGAAAGAGGGAGAGGAAGGGGG - Intronic
928274087 2:29883079-29883101 GAGGAAGGGAGAGAGGAAGGAGG + Intronic
928293790 2:30063597-30063619 CTAGAAGGAAGACAGGAAGGAGG + Intergenic
928602359 2:32915973-32915995 GAGGAAGGGAGGGAGGAAGGAGG - Intergenic
928713986 2:34039116-34039138 CTGGAAGAGAGGGAAGAAGGAGG - Intergenic
928955123 2:36858277-36858299 ATGGAAGGACAAAAGGAAGGGGG - Intronic
929322484 2:40561407-40561429 CTAGTGGGGCGAGAGGAAAGAGG - Intronic
929667803 2:43846888-43846910 CTGGTAGGGAGAAAGAAAGGTGG - Intronic
930272398 2:49272051-49272073 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
931215380 2:60237313-60237335 CTGGAATGGGGTGAGGGAGGGGG - Intergenic
931430877 2:62208212-62208234 AAGGAAGGGGGAAAGGAAGGGGG - Intronic
932291243 2:70581845-70581867 CAGGAAGAGAGAGAGGAAAGGGG - Intergenic
932493490 2:72135420-72135442 CTGGAAGGCAGAGAGGCAAGTGG + Intronic
933242366 2:79936482-79936504 CTCGAAGGGCCAGAGGATGCCGG - Intronic
933612094 2:84446705-84446727 AAGGAAGGGAGAGAGGGAGGGGG + Intronic
933750988 2:85602105-85602127 CGGGAAGGGGGAGGGGAAGGGGG + Exonic
933946240 2:87288533-87288555 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
933958574 2:87394176-87394198 CCCGGAGAGCGAGAGGAAGGAGG - Intergenic
933976313 2:87514836-87514858 CTGGAAGGGCTATTGGAGGGAGG + Intergenic
934242703 2:90286182-90286204 CCCGGAGAGCGAGAGGAAGGAGG - Intergenic
934270472 2:91530501-91530523 CCCGGAGAGCGAGAGGAAGGAGG + Intergenic
934686163 2:96323327-96323349 CTGGGAAGGGGAGGGGAAGGTGG + Intergenic
934767091 2:96885682-96885704 CAGGAAGCCAGAGAGGAAGGTGG - Intronic
935126750 2:100231106-100231128 CTGGAAGGGATGGAGGGAGGTGG - Intergenic
935404489 2:102694606-102694628 ATGGCAGGGTGAGAGGGAGGAGG + Intronic
936118816 2:109724514-109724536 ATGGAAGGGGGACAGGTAGGTGG + Intergenic
936317509 2:111435970-111435992 CTGGAAGGGCTATTGGAGGGAGG - Intergenic
936333975 2:111573050-111573072 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
937072272 2:119073329-119073351 CAGGCAGGGAGGGAGGAAGGAGG + Intergenic
937847507 2:126597779-126597801 CAGGAAGGGAGGGAGGAGGGGGG - Intergenic
937914010 2:127090103-127090125 CTTGATTGGAGAGAGGAAGGGGG - Intronic
938220659 2:129564464-129564486 CTGGTAGGGAGAAAGGAACGAGG - Intergenic
938670385 2:133580980-133581002 GAGGAAGGGAAAGAGGAAGGAGG - Intergenic
939428625 2:142073819-142073841 GAGGAAGAGAGAGAGGAAGGAGG - Intronic
939498647 2:142952903-142952925 ATGGCAGGGTGAGTGGAAGGAGG - Intronic
940148873 2:150577624-150577646 CAGGAAGAGAGAGAGGAGGGAGG + Intergenic
940464266 2:154008572-154008594 CAGGGAGGGTGGGAGGAAGGTGG - Intronic
940527507 2:154835687-154835709 AAGGAAGGGAGAGAGAAAGGAGG - Intronic
940986847 2:160059396-160059418 CTGGATTGGCCAGAGGAAGAGGG + Intronic
941088004 2:161141471-161141493 GTTGAGGGGCAAGAGGAAGGAGG - Intronic
941777522 2:169408934-169408956 CAGGAAGGGAGAGAGAAATGTGG - Intergenic
942045499 2:172097157-172097179 GTGAAGGGGCCAGAGGAAGGGGG - Intergenic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942296640 2:174523901-174523923 CTGGCAGTAGGAGAGGAAGGAGG - Intergenic
942591531 2:177552318-177552340 AGGGAAGGGGGAGAGGAAAGTGG - Exonic
946181035 2:217949039-217949061 CAGGCAGGGTGAGAGGAGGGAGG - Intronic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946579783 2:221115849-221115871 GAGGAAGGGAGAGAGGAATGAGG - Intergenic
947030131 2:225783270-225783292 GTGGAAAGGGGAAAGGAAGGAGG - Intergenic
947042765 2:225942458-225942480 GAGGGAGGGCGAGAGGAAGGAGG + Intergenic
947077768 2:226364049-226364071 CAGGAAGGGAGAGAGGAAGGAGG + Intergenic
947367144 2:229408420-229408442 GGGGAAGGGAGAGAGGGAGGAGG - Intronic
947498979 2:230658725-230658747 CAGGCAGGGCCAGAGGCAGGCGG - Intergenic
947624823 2:231612908-231612930 CTGGGAGGGAGAAGGGAAGGGGG + Intergenic
947770565 2:232667085-232667107 CTGGAAGTGCAAGAACAAGGTGG - Intronic
947868924 2:233421633-233421655 CTGGAAGGAAGCAAGGAAGGAGG - Intronic
947948843 2:234130216-234130238 CAGGAAAGGGGAGAGAAAGGAGG - Intergenic
947948848 2:234130235-234130257 CTGTAAGGGAGGGAGGAAGCAGG - Intergenic
947991273 2:234489405-234489427 GGGGAAGGGGGAGGGGAAGGAGG + Intergenic
948149568 2:235734309-235734331 CTGGAAGGGAGAAAGACAGGAGG - Intronic
948196260 2:236098986-236099008 ATGTAAGGACTAGAGGAAGGAGG + Intronic
948711571 2:239828755-239828777 ATGGAAGGGCCACAGGACGGAGG + Intergenic
948711585 2:239828798-239828820 ATGGAAGGGCCACAGGACGGAGG + Intergenic
1169221290 20:3824563-3824585 CTGGCAGGGATGGAGGAAGGTGG - Exonic
1169373282 20:5044961-5044983 CAAGAAGGGAGTGAGGAAGGAGG - Intergenic
1169437186 20:5603049-5603071 TTGGGAGGCCGAGAGGCAGGTGG + Intronic
1169833121 20:9847243-9847265 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
1170501916 20:16982780-16982802 CAGGAAGGGAGGGAGGAAGAAGG - Intergenic
1170879957 20:20288228-20288250 CAGGAAGGGGAAGAGGATGGAGG + Intronic
1170904650 20:20502667-20502689 GTGGTAGGGAGAGAGTAAGGTGG + Intronic
1171328510 20:24317463-24317485 CTGAAAGCGAGAGAGGAAGGAGG - Intergenic
1171437786 20:25136511-25136533 GTGGAAGGGCAAAAGGAGGGAGG - Intergenic
1172344607 20:34188045-34188067 CTGGAAGTGCGAGGGGAAGATGG - Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173227787 20:41172060-41172082 CTGGAAGGTACAGGGGAAGGTGG + Intronic
1173481899 20:43407883-43407905 GTAGAAGGTGGAGAGGAAGGAGG - Intergenic
1174102254 20:48136758-48136780 CTGGAAAGGGGATGGGAAGGTGG - Intergenic
1174264113 20:49318965-49318987 CTTGAAGGGCGGCAGGAAGGTGG + Intergenic
1174595163 20:51678125-51678147 GTGGCAGGGCGGGGGGAAGGGGG + Intronic
1174998909 20:55604428-55604450 GAGGAAGGGAGAGAGGAAAGAGG - Intergenic
1175373157 20:58506263-58506285 CTGGATGGGTCAGAGGAAGATGG - Intronic
1175666385 20:60863765-60863787 ATGGAAGGGAGAAAGGAAGGAGG + Intergenic
1175715244 20:61251203-61251225 CTGGGAGGGAGAGAGGGAAGCGG + Intergenic
1175973999 20:62701382-62701404 GTGGTGGGGGGAGAGGAAGGAGG - Intergenic
1176130116 20:63493248-63493270 CTGGAAGGTGGAGCGTAAGGAGG - Exonic
1176513651 21:7767344-7767366 AGGGAAGGGAAAGAGGAAGGGGG - Intronic
1177232982 21:18347059-18347081 TTGGAAGGGGAAGTGGAAGGAGG - Intronic
1178151001 21:29793529-29793551 CAGGAAGGGGGAGAAGGAGGAGG - Intronic
1178581089 21:33839323-33839345 CTGGCAGGGCCAGGGGAGGGTGG + Intronic
1178647764 21:34397868-34397890 AGGGAAGGGAAAGAGGAAGGGGG - Intronic
1178694312 21:34779991-34780013 CTGGAAGGTGAAGAGGAAGTAGG - Intergenic
1179066850 21:38032753-38032775 CTGGAAATGAGAAAGGAAGGTGG - Intronic
1179374780 21:40840846-40840868 GTGGACGGGAGGGAGGAAGGTGG + Intronic
1179919139 21:44498003-44498025 CTGGAGGGGGCAGAGGGAGGAGG + Exonic
1180070836 21:45435212-45435234 ATGGGAGGAAGAGAGGAAGGTGG + Intronic
1180231064 21:46426961-46426983 CTGGAGGGGCGAGCGGAGGCGGG - Intronic
1180766210 22:18347010-18347032 CTGCAAGGGTGAGATGGAGGTGG + Intergenic
1180780103 22:18515368-18515390 CTGCAAGGGTGAGATGGAGGTGG - Intergenic
1180812819 22:18772689-18772711 CTGCAAGGGTGAGATGGAGGTGG - Intergenic
1180839446 22:18952310-18952332 CTGGAGGGGCAGGAGCAAGGAGG + Intergenic
1181198977 22:21206937-21206959 CTGCAAGGGTGAGATGGAGGTGG - Intergenic
1181350373 22:22250821-22250843 CCCGGAGAGCGAGAGGAAGGAGG + Intergenic
1181442223 22:22942493-22942515 CTGGAAGGAGGGGAGGCAGGAGG - Intergenic
1181704967 22:24644488-24644510 CTGGGAGGGGCAGAGGGAGGAGG + Intergenic
1181746362 22:24957496-24957518 CTGGATGGGTGAGTGGAAGAAGG - Intronic
1182094383 22:27616189-27616211 CTGGAAGGAGGAGGGGGAGGTGG - Intergenic
1182185281 22:28395322-28395344 CTGGAAGGGATAGAAGAAGGAGG - Intronic
1182230285 22:28832575-28832597 TTGGGAGGCCGAGAGGCAGGTGG + Intergenic
1182767011 22:32764981-32765003 CTGGAAGGACAAGAGGGTGGGGG - Intronic
1183419739 22:37704461-37704483 GGGGAAGGGGGAGGGGAAGGGGG + Intronic
1183508415 22:38221747-38221769 CTGGGACGGTGAGAGGGAGGTGG + Intronic
1183672550 22:39281595-39281617 CTGGATGTGCAAGAGGGAGGCGG + Intergenic
1183687103 22:39367445-39367467 GTGGTAGGGGGAGTGGAAGGAGG + Intronic
1183697366 22:39430877-39430899 CTGGAACTGCCAGAGGATGGCGG + Exonic
1183716412 22:39535833-39535855 CTGGGAGGCTGAGAGGCAGGTGG + Intergenic
1184093743 22:42305647-42305669 CTGGAAGGACGAATGGGAGGTGG - Intronic
1184127771 22:42500297-42500319 CTGGCAGGGCGGTGGGAAGGCGG + Intergenic
1184255636 22:43285359-43285381 GGGGAAGGAAGAGAGGAAGGTGG - Intronic
1184598978 22:45531685-45531707 CTGGAAGGGGAAAGGGAAGGAGG - Intronic
1184939143 22:47748165-47748187 ATGGAAGGGGCAGAGGGAGGAGG + Intergenic
1184972181 22:48031830-48031852 GTGGAATGGCCAGAGGAAAGTGG - Intergenic
1185154341 22:49184063-49184085 CTGGAATTGCGAGAGGACAGGGG + Intergenic
1185156253 22:49195198-49195220 CTGGGAGGCCGAGAGGAAGGAGG - Intergenic
1185202468 22:49516669-49516691 ATGGGAGGGAGAGAGGGAGGAGG + Intronic
1203227828 22_KI270731v1_random:87901-87923 CTGCAAGGGTGAGATGGAGGTGG + Intergenic
949520589 3:4849948-4849970 CTGGAAGGGAGATAGCAAGTGGG - Intronic
949810056 3:7997699-7997721 GTGGCAGTGAGAGAGGAAGGAGG + Intergenic
950098388 3:10343247-10343269 CTGGAGGGGAGAGGGGAAGATGG - Intronic
950361362 3:12451725-12451747 CTGGAAGGCCAAGATCAAGGTGG - Intergenic
950475970 3:13215042-13215064 CTGCAGAGGCGAGAGGCAGGTGG + Intergenic
950901864 3:16505220-16505242 CTGGAAAGGAGGGAGGATGGAGG - Intronic
951417683 3:22444993-22445015 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
951485497 3:23204118-23204140 CGGGAAGGGGGAGAGGACAGAGG - Intronic
951719142 3:25679633-25679655 GGGGAAGGGCGAGGGGAAAGGGG + Intergenic
951858690 3:27226380-27226402 CTGAAAGAGAAAGAGGAAGGTGG + Intronic
953271389 3:41448641-41448663 CTGTAAGGGCAGGAGGATGGTGG + Intronic
953385888 3:42505449-42505471 CTGGAGAGGCTAGAGGCAGGTGG - Intronic
953444831 3:42954441-42954463 CAGGAAGGGAGAGAGGTAGCAGG - Intronic
954553321 3:51499820-51499842 CGGGAGGGGCGCGAGGAAGCAGG - Intronic
954760588 3:52870891-52870913 CTGGAAGGTCTGGGGGAAGGCGG + Intronic
954820295 3:53320764-53320786 CGGGAGGGGCCAGAGCAAGGTGG - Intronic
955087811 3:55720079-55720101 ATGGGAGGGGGAGGGGAAGGGGG - Intronic
955557502 3:60153795-60153817 CTGGAAGGGCCTGGGGAAGGGGG - Intronic
956017452 3:64898542-64898564 CAGGAAGAGGGAGAGGAAGTTGG + Intergenic
956400618 3:68875573-68875595 CTGGAAGTGGGACAGGAAGAAGG + Intronic
956876376 3:73467929-73467951 CTGCCAGGGTTAGAGGAAGGAGG + Intronic
956960922 3:74399819-74399841 TGGGAAGGGCAGGAGGAAGGGGG - Intronic
958721687 3:97851614-97851636 TAGGGAGGGAGAGAGGAAGGAGG + Intronic
958732584 3:97974512-97974534 CGGGGAGGGAGGGAGGAAGGGGG + Intergenic
960213404 3:114999118-114999140 AGGGAAGGGGAAGAGGAAGGGGG + Intronic
961654783 3:128435280-128435302 CAGGAAAGGCCAGTGGAAGGTGG + Intergenic
962134932 3:132722720-132722742 CGGGGAGGGAGAGCGGAAGGGGG + Intergenic
962806033 3:138928558-138928580 CTGAAAGGGTGAGAGGAAAATGG - Intergenic
962845564 3:139270879-139270901 ATGGAAGGGGAAGAGGAAGTAGG - Intronic
963061879 3:141232310-141232332 CTGGAAGGGCGGGGGCGAGGTGG - Intronic
963309027 3:143687994-143688016 GAGGAAGGGAGAGAGGGAGGAGG - Intronic
963577330 3:147077335-147077357 CTGGAAGGGAGAGGGAAAGAAGG + Intergenic
963605414 3:147408803-147408825 CTTGAAGGGAGGGGGGAAGGGGG + Intronic
964813941 3:160696198-160696220 CTGGATGAGAGAGAGGATGGGGG - Intergenic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
965521011 3:169668224-169668246 CTGGGGGAGCGAGAGGAGGGTGG + Intergenic
966748895 3:183303563-183303585 CTGGGAGGGTAAGAGGAAAGGGG - Intronic
967326874 3:188249794-188249816 GAGGAAGGGAGGGAGGAAGGGGG - Intronic
967899966 3:194440030-194440052 TTGAAAGGGAGAGAGGGAGGAGG - Intronic
968645384 4:1738024-1738046 GTGGGAGGGCGGGAGGAAAGGGG - Intronic
968814918 4:2817326-2817348 CTGGCAGGGCGGCTGGAAGGAGG + Intronic
969081873 4:4625311-4625333 CTGGGAGGGCGAGCTGAGGGTGG + Intergenic
969456723 4:7304474-7304496 CTGGATGGACGGGAGGCAGGAGG - Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
970001193 4:11367760-11367782 CAGGAAGGGGAAGAGGAGGGAGG - Intergenic
970246327 4:14067931-14067953 CTGGGAGGTAGAGGGGAAGGGGG + Intergenic
970544619 4:17114834-17114856 CTGGAAGGGAGGGAGGGAGAAGG - Intergenic
970601337 4:17643091-17643113 CTGGAAGAGCAAGAGCAGGGGGG + Intronic
971005672 4:22371790-22371812 GTGGAAAGGTAAGAGGAAGGAGG - Intronic
971034150 4:22675087-22675109 GAGGAAGGGAGGGAGGAAGGGGG - Intergenic
972436937 4:39044445-39044467 CTGGAAGGCCGTGAGAGAGGCGG - Intergenic
972573581 4:40331862-40331884 ATGGAAGGGGGAGAGGAAGAGGG + Intergenic
973543173 4:51954352-51954374 GTGGAAGGTGGAGAGGAAAGAGG - Intergenic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
974597694 4:64036632-64036654 GGGGAAGGGGGAGGGGAAGGGGG - Intergenic
975473296 4:74794368-74794390 CGGGAAGGGGGCGAAGAAGGAGG - Exonic
976079573 4:81340325-81340347 CTGGAAGGGGGAGAGTGGGGAGG - Intergenic
976883209 4:89955532-89955554 GTGGAAGGGGGAGAGGTAGGAGG + Intergenic
977290557 4:95160587-95160609 GAGGAAGGGAGGGAGGAAGGAGG - Intergenic
977345073 4:95807357-95807379 CTCCAAGGGAGATAGGAAGGTGG + Intergenic
978625396 4:110679705-110679727 AGGGAATGGAGAGAGGAAGGGGG - Intergenic
980702698 4:136453911-136453933 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
980879718 4:138697533-138697555 GTAGAAGAGAGAGAGGAAGGTGG - Intergenic
980940338 4:139268116-139268138 AGGGAAGGGGGAAAGGAAGGGGG + Intronic
984252833 4:177355027-177355049 CTGGGAGGGCCAGATAAAGGGGG - Intronic
985000339 4:185476178-185476200 AGGGAAGGACGTGAGGAAGGAGG - Intergenic
986241637 5:5965307-5965329 CTAGAAGGGAGAGAGGAGTGAGG - Intergenic
986285613 5:6356187-6356209 TTAGAAGTGGGAGAGGAAGGTGG - Intergenic
986305410 5:6510636-6510658 GTGGAAGGGACAGAGGAAGCAGG + Intergenic
986467640 5:8042387-8042409 CTGGCAGGGAGAGAGGAAAATGG - Intergenic
986631606 5:9779194-9779216 GAGCAAGGGAGAGAGGAAGGAGG - Intergenic
986768532 5:10950126-10950148 GTGGAATGGACAGAGGAAGGAGG + Intergenic
989130426 5:38101624-38101646 CTGGGAGGGGGTGAGGAAGAAGG + Intergenic
989343572 5:40404277-40404299 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
989770614 5:45140222-45140244 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
990224522 5:53634606-53634628 AGGGAAGAGGGAGAGGAAGGAGG - Intronic
990878224 5:60510630-60510652 CTGGAAGGGCAAGAGTACGGAGG + Intronic
991245885 5:64507455-64507477 CTGAAAGGGTGAGGGGAAGTAGG + Intronic
991433588 5:66573377-66573399 AGGGAAGGAGGAGAGGAAGGAGG + Intergenic
992120780 5:73589892-73589914 CTGGAAGGGCTAGAAGAATAGGG + Intergenic
992268925 5:75046234-75046256 CTGGAAAGGCTAAAGGAAGAAGG + Intergenic
992302986 5:75404175-75404197 CTGGAAGGGTGGGAGGTATGGGG + Intronic
992578975 5:78151839-78151861 GGGGAAGGGGGAGGGGAAGGGGG - Intronic
994864867 5:105255024-105255046 ATGGAAGGAAGGGAGGAAGGAGG + Intergenic
995031971 5:107491311-107491333 ATGGAAGGAAGGGAGGAAGGAGG - Intronic
996700499 5:126445896-126445918 CAGGAAGGGCAAGAGAAAAGGGG + Intronic
996802752 5:127421622-127421644 CTGGAAGGGGAGGAGCAAGGAGG + Intronic
997367163 5:133333392-133333414 CTGGAAGCAGGAGAGAAAGGAGG - Intronic
997437601 5:133886170-133886192 CTTGAAGGCAGAGAGGAAGGAGG - Intergenic
997899812 5:137754224-137754246 AAGGAAGGAAGAGAGGAAGGGGG + Exonic
998206100 5:140157736-140157758 TTGGATGGTAGAGAGGAAGGAGG - Intergenic
998253847 5:140570176-140570198 CTGGCAGGGCCAGTGGGAGGAGG - Intronic
998472509 5:142394182-142394204 CTGGGAGGGGGAGGGGGAGGTGG - Intergenic
998641185 5:144013093-144013115 CTGGCAGGGATAGATGAAGGAGG - Intergenic
999261519 5:150241568-150241590 CAAGAAGGAAGAGAGGAAGGAGG - Intronic
999301256 5:150491951-150491973 TGGGAAGGGGGAGAGGATGGCGG + Intronic
999865371 5:155695147-155695169 CTGGAAGGCCGGGAATAAGGAGG - Intergenic
1000791189 5:165609533-165609555 CTGGAGGGGTGCGAGGAGGGAGG - Intergenic
1000847013 5:166294181-166294203 CTGGAAGTGCCAGATGAAGAGGG - Intergenic
1001133244 5:169081285-169081307 CTGGGAAGAGGAGAGGAAGGAGG + Intronic
1001165306 5:169360293-169360315 GTGAGAGGGTGAGAGGAAGGTGG + Intergenic
1001254902 5:170176025-170176047 GTAGAAGGGAGAGAGGAAGTGGG - Intergenic
1001275090 5:170344947-170344969 CTGGAAGGGAGTGAGGGAGGGGG + Intergenic
1001720221 5:173851038-173851060 CAGGAAGGGAGGGAGGAAAGAGG + Intergenic
1001942822 5:175752732-175752754 ATGGAAGGGGGAGAGGAGGTGGG + Intergenic
1002210392 5:177595518-177595540 CTGGAAGGGAGAGGGGCTGGAGG + Exonic
1002345011 5:178542681-178542703 TGGGAAGGTGGAGAGGAAGGGGG + Intronic
1002563132 5:180096150-180096172 CAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1003061358 6:2865295-2865317 CGGGGAGGGAGGGAGGAAGGAGG - Intergenic
1003326492 6:5095734-5095756 TTGGAAGGCCGAGAGGCAGGTGG + Intergenic
1004026605 6:11825433-11825455 CGGGAAGGGTGTGAGGATGGAGG + Intergenic
1004090370 6:12494525-12494547 GTGGTATGGCGAGAGGAAGGAGG - Intergenic
1005681679 6:28215206-28215228 TTGGAATGATGAGAGGAAGGTGG - Intergenic
1005811331 6:29518596-29518618 CTGGAAGAGCCACAGGAATGGGG + Intergenic
1005870726 6:29972616-29972638 CTGGGAGGGCAGGAGGATGGAGG + Intergenic
1006000044 6:30957357-30957379 TTGGAAGGGGAAGATGAAGGTGG - Intergenic
1006405189 6:33841122-33841144 CTGGAAGAGAGACAGGGAGGAGG - Intergenic
1006509507 6:34514550-34514572 CTGGAAGGACGATTGGGAGGTGG + Intronic
1006598173 6:35208733-35208755 CTGGAAGGACAAGAGGCAGCAGG + Intergenic
1006681376 6:35798951-35798973 ATGTAAAGGTGAGAGGAAGGGGG - Intergenic
1007399122 6:41593810-41593832 TTGGAAGGGAGAGAGGGAGAGGG + Intronic
1008717388 6:54305569-54305591 CTGGAAGGAAGAAAGGAAGATGG + Intergenic
1008894280 6:56534712-56534734 CTGGAATGGAGGGAGGGAGGGGG - Intronic
1009449470 6:63784549-63784571 ATGGAAGGTGAAGAGGAAGGAGG + Intronic
1009618627 6:66043491-66043513 GTAGAAGGTAGAGAGGAAGGAGG - Intergenic
1009652976 6:66499898-66499920 AAGGAAGAGAGAGAGGAAGGAGG - Intergenic
1009826692 6:68875218-68875240 GAGGGAGGGGGAGAGGAAGGGGG - Intronic
1010196882 6:73248436-73248458 CCAGGAGGGAGAGAGGAAGGAGG - Intronic
1010604489 6:77871542-77871564 CTAGCAGGGAGAGAGGGAGGAGG + Intronic
1011563479 6:88647741-88647763 GAGGAAGGGAGAGAGGGAGGAGG + Intronic
1012032086 6:94083972-94083994 TTGGAAGGCTGAGAGGCAGGAGG + Intergenic
1012595748 6:101036584-101036606 TTGGAAGGCTGAGAGGCAGGAGG + Intergenic
1012959690 6:105609433-105609455 CTGGTAAAGGGAGAGGAAGGAGG - Intergenic
1013192160 6:107812658-107812680 CTGGAAGGGAGTCAGGCAGGGGG - Intronic
1013240098 6:108237265-108237287 TTGGAAGGTGGAGAGAAAGGTGG - Intronic
1013537248 6:111074693-111074715 GAAGAAGGGAGAGAGGAAGGAGG + Intergenic
1013779049 6:113710308-113710330 CTGAAAGGGCGAGGGTCAGGTGG + Intergenic
1014169653 6:118264953-118264975 TTGGAGGGGCTACAGGAAGGAGG - Intronic
1014287403 6:119515961-119515983 ATGGAAGGGAGAGAAGAAGGGGG - Intergenic
1014913292 6:127118573-127118595 CAGGGAGGGGGAGAGGAGGGGGG - Intergenic
1015257839 6:131199987-131200009 CTTGAAGAGCGACAGGAAGAGGG - Intronic
1015549582 6:134398158-134398180 TGGGAAGGGTAAGAGGAAGGAGG + Intergenic
1015590037 6:134814345-134814367 CTGGAAGGAAGTGAGGAAGCAGG + Intergenic
1016000098 6:139033151-139033173 CTGGAGGTGAGAGAGCAAGGGGG + Intronic
1016878598 6:148888145-148888167 GTGGAAGGCAGAGAGGAAGCAGG + Intronic
1017014447 6:150088841-150088863 GGGGAAGGGGGAGAGGGAGGGGG + Intergenic
1017024332 6:150168067-150168089 CGGAAAGGGAGAGAGCAAGGTGG - Intronic
1017624924 6:156338608-156338630 GAGGAAGGGAGGGAGGAAGGGGG - Intergenic
1017663449 6:156696002-156696024 CTGGAATGGGGTGAGGCAGGAGG - Intergenic
1017816693 6:158021537-158021559 CTGGGAGGGCTGGAGGGAGGAGG + Intronic
1017920863 6:158870723-158870745 GAGGGAGGGAGAGAGGAAGGGGG - Intronic
1017927715 6:158924658-158924680 AGGGAAGGGGGAGAGGGAGGAGG + Intergenic
1017966500 6:159271304-159271326 CTGGAAGGGCAACAGGAGAGGGG - Intronic
1018228547 6:161654459-161654481 CTGCAATGCCGAGAGGGAGGAGG + Intronic
1018465955 6:164045219-164045241 GTGGAAGGCAGAGAGGAAGCAGG + Intergenic
1018669379 6:166166995-166167017 CTGGCAGGGCTCGGGGAAGGGGG - Intronic
1018723258 6:166589969-166589991 CAGGAAGGGCCAGAGGAAGAAGG + Intronic
1019313495 7:374124-374146 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1019313521 7:374301-374323 CTGGAAGAGGGAGAGGAACACGG - Intergenic
1019327741 7:446520-446542 CTGGGAGGGGGAGAGGCAGGTGG - Intergenic
1019335706 7:481590-481612 CGGGAAGGGAGGGAGGAGGGTGG - Intergenic
1019413141 7:915326-915348 CTGGATGGGTGTGAGGATGGTGG - Intronic
1019728513 7:2616811-2616833 CTGGATGGGGAAGAGGAAGAGGG - Intergenic
1019758020 7:2787709-2787731 CGGGAAGGGGGAGAGGCCGGGGG + Intronic
1020039987 7:4994774-4994796 CTGGAAAAGGGAGAGGCAGGTGG + Intronic
1020354130 7:7258264-7258286 ATGGAAGGGGGAAAGGAATGGGG + Intergenic
1020470647 7:8530634-8530656 CTGGAGGGGCATGAGGGAGGAGG + Intronic
1021656631 7:22880207-22880229 CAGGATGGGCAAGAGGAAGCAGG - Intergenic
1021726809 7:23555243-23555265 CAGGAAGGGTAGGAGGAAGGGGG - Intergenic
1021873561 7:25027635-25027657 CAGGAAGGGCGAGCTGAGGGAGG + Intergenic
1022327022 7:29341606-29341628 ATGGGAGGGAGAGAGGGAGGGGG + Intronic
1023840914 7:44097028-44097050 CTGGAGGGAGGAGGGGAAGGTGG + Intergenic
1023991687 7:45132543-45132565 GAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1024569990 7:50715282-50715304 CTGGCAGGGCAAGAGGACGGCGG + Intronic
1025142448 7:56477434-56477456 GTGGAAGGGGAAGAGGAAGCAGG - Intergenic
1025235085 7:57228886-57228908 CTGGCAGGGCGAGAGGTTTGCGG - Intergenic
1025610956 7:63075257-63075279 GTGGAAGGGGAAGAGGAAGCAGG + Intergenic
1025824186 7:64997519-64997541 CTGCAAGGGCTAAAGGAAGGTGG - Intronic
1026133134 7:67636771-67636793 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1026357080 7:69567484-69567506 CTGGAAGGAGGAGAGGGAGTGGG + Intergenic
1026588901 7:71679925-71679947 GAGGAAGGGAGAGAGGGAGGAGG - Intronic
1026588954 7:71680080-71680102 GAGGAAGGGAGAGAGGGAGGAGG - Intronic
1026928638 7:74210597-74210619 CTGGGAGGGAGAGAGGGAGGCGG - Intronic
1027144327 7:75683526-75683548 CTGGAGGGGCAGGAGGAAGCTGG + Intronic
1027484940 7:78749779-78749801 AGGGAAGAGAGAGAGGAAGGAGG + Intronic
1028433514 7:90775631-90775653 GGGGAAGGGGGAGGGGAAGGGGG - Intronic
1028776600 7:94684329-94684351 TAAGAAGGGAGAGAGGAAGGGGG - Intergenic
1029697167 7:102221080-102221102 ATGGAAGGGCGGGTGGAAGGAGG - Intronic
1029853482 7:103489305-103489327 CTGGAAGAGGCTGAGGAAGGAGG + Intronic
1030061059 7:105621733-105621755 CTGGGAGGCCTGGAGGAAGGGGG - Intronic
1030174351 7:106636033-106636055 AAGGAAGGGAGAGAGGGAGGCGG + Intergenic
1030509906 7:110471236-110471258 GGGGGAGGGAGAGAGGAAGGAGG + Intergenic
1030636627 7:111956715-111956737 CTGGAGGGGAAAGAAGAAGGTGG - Intronic
1031180273 7:118405126-118405148 CTGGGAGGGTAATAGGAAGGTGG - Intergenic
1032401092 7:131624881-131624903 CTGGAAAGGCTAGAGGATGGTGG + Intergenic
1032986091 7:137338960-137338982 TTGGAGAGGAGAGAGGAAGGCGG + Intronic
1033293895 7:140114176-140114198 GTGGAAAGGGGAGGGGAAGGGGG - Intronic
1033601890 7:142894344-142894366 CTGGGAGGCTGAGAGGAAGGTGG + Intergenic
1034295888 7:149972158-149972180 AGGGAAGGGCGGGAGGATGGGGG - Intergenic
1034451829 7:151141350-151141372 CAGGAAGGGCAAGTGGATGGGGG - Intronic
1034810165 7:154124744-154124766 AGGGAAGGGCGGGAGGATGGGGG + Intronic
1034944932 7:155255673-155255695 GGGGAAGGGGGAGAGGGAGGGGG + Intergenic
1035097463 7:156366756-156366778 CGGGAAGAGTGAGAGGGAGGAGG + Intergenic
1036207258 8:6814475-6814497 TGGCAGGGGCGAGAGGAAGGGGG + Intronic
1036456468 8:8913272-8913294 GTGGAAGGGGAAGAGGAAGCAGG - Intergenic
1036581882 8:10082443-10082465 TTAGGAGGGCGAAAGGAAGGAGG - Intronic
1036607016 8:10316592-10316614 GAGGAAGGGAGAGAGGGAGGGGG - Intronic
1036688874 8:10928774-10928796 CTGGAAGGTGGAGAAGGAGGGGG - Intronic
1037098917 8:15018879-15018901 GTGGAAGGCGGAGAGGAAGAAGG + Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037886518 8:22599038-22599060 GGGGAGGGGCGAGAGGAGGGAGG - Intronic
1037886654 8:22599395-22599417 GGGGAGGGGCGAGGGGAAGGGGG - Intronic
1038165909 8:25084933-25084955 CTGGAAGGGCAAGAAGACAGAGG + Intergenic
1038927269 8:32154427-32154449 CAGGAAGGAAGAGAGGAAGTGGG - Intronic
1039326663 8:36492753-36492775 CTCGAAGGTAGAGAGGGAGGAGG - Intergenic
1039473813 8:37829035-37829057 GTGGGGGGGTGAGAGGAAGGGGG - Intronic
1039738090 8:40354025-40354047 CTGGAAGGATGAGTGGGAGGTGG + Intergenic
1041005647 8:53494944-53494966 CAGGAAGGCCTAGAGGAGGGAGG + Intergenic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1042101990 8:65283884-65283906 GAGGAAGGGAGAGGGGAAGGAGG + Intergenic
1042421004 8:68589553-68589575 AAGGAAGGGAGAGAGAAAGGTGG + Intronic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042943150 8:74127747-74127769 ATGGAAGGGAGGGAGGGAGGGGG - Intergenic
1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG + Intergenic
1044582753 8:93838453-93838475 GTGGAAGGGAAAGAGGAAGCAGG + Intergenic
1044826418 8:96202495-96202517 CTGGAAAGGGTAGGGGAAGGAGG - Intergenic
1045314951 8:101035570-101035592 CTGGAAGAGCAACAGGAATGAGG + Intergenic
1045535485 8:103023165-103023187 CGGGGAGGGAGAGAGGCAGGTGG + Intronic
1046017811 8:108627214-108627236 CTGGAAGTGTGGGAGGAGGGAGG - Intronic
1046094406 8:109540056-109540078 GTGGAAGGGCGAAAGGAAGGTGG - Intronic
1046620339 8:116522460-116522482 CTGGAAGACAGAGAGGAAGTGGG + Intergenic
1047041326 8:120999285-120999307 CTGGAACGACTAAAGGAAGGAGG + Intergenic
1047305561 8:123650097-123650119 CAGGAGAGGAGAGAGGAAGGTGG - Intronic
1047511855 8:125521665-125521687 GGGGAAGGACGGGAGGAAGGAGG - Intergenic
1048127004 8:131646962-131646984 CAGGAAGGCAGAAAGGAAGGCGG + Intergenic
1048483039 8:134819242-134819264 TGGGAAGGGGAAGAGGAAGGGGG + Intergenic
1048841286 8:138568669-138568691 AAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1048998596 8:139809892-139809914 CTGGGGTGGCGGGAGGAAGGGGG - Intronic
1049053509 8:140217323-140217345 CTGGAATGGCACAAGGAAGGTGG + Intronic
1049231754 8:141488361-141488383 CAGGGAGGATGAGAGGAAGGAGG - Intergenic
1049361187 8:142213180-142213202 AGGGAAGGGGGAGAGGAAGAGGG - Intronic
1049529163 8:143145668-143145690 TTGGAAGGCTGAGAGGCAGGAGG + Intergenic
1050172455 9:2836133-2836155 GAGGTAGGGAGAGAGGAAGGAGG - Intronic
1050478452 9:6064883-6064905 CTGAAGGGGCATGAGGAAGGTGG + Intergenic
1050876199 9:10640022-10640044 GTGGAAGGTACAGAGGAAGGAGG + Intergenic
1051274650 9:15387163-15387185 CAGGAAGAGAGAGAGGAGGGAGG - Intergenic
1052841419 9:33294545-33294567 CTGGAAAGGTGACAGGGAGGTGG - Exonic
1052851448 9:33380824-33380846 CTGGAATGGAAAGAGGAAAGGGG - Intergenic
1053123420 9:35561933-35561955 TTGGAAGGGAGAGAGGTGGGTGG - Exonic
1053185125 9:36009484-36009506 GAGGAAGGGAGAGAAGAAGGGGG + Intergenic
1053398190 9:37794335-37794357 ATGGAAGGGGGGGAGGGAGGAGG + Intronic
1054901148 9:70370757-70370779 AGGGGAGGGGGAGAGGAAGGGGG + Intergenic
1055930586 9:81555927-81555949 GTAGAAGGAGGAGAGGAAGGAGG - Intergenic
1056102761 9:83315600-83315622 GTGGAAGGCAAAGAGGAAGGAGG - Intronic
1056179754 9:84070731-84070753 GTGGAAGGTGAAGAGGAAGGAGG + Intergenic
1056463084 9:86826872-86826894 CTGCAAGGAAGAGAGGAATGGGG - Intergenic
1056706717 9:88958322-88958344 CTGGAAGAGTGAGGGGAAGCAGG - Intergenic
1057385182 9:94600379-94600401 CTGGAAGGCCCAGAGGAAGGGGG + Intergenic
1057643842 9:96854376-96854398 CCGGAAGCGGGAGAGGAAGCGGG - Exonic
1058411588 9:104738956-104738978 CGGGAAGGGAAAGAGGAAAGAGG + Intergenic
1059285219 9:113166530-113166552 CTGAGAGAGCGAGAGGAAGTGGG + Intronic
1059389240 9:113988468-113988490 CTGGCAGGGCGAGGCCAAGGAGG + Exonic
1059787104 9:117597838-117597860 CTGGAAGGGGCAGAGGCTGGGGG - Intergenic
1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG + Intergenic
1060116137 9:120942513-120942535 GGGGAAGGGAGAAAGGAAGGAGG + Intergenic
1060141268 9:121212439-121212461 CTGGCAGGGAGAGAAGAGGGTGG - Intronic
1060347314 9:122828297-122828319 CTGGAAGGGCCCGGGGGAGGTGG + Intronic
1060413379 9:123414339-123414361 CTGGGAGGGGGAGAGGCTGGAGG - Intronic
1060527180 9:124327263-124327285 GGGGCAGGACGAGAGGAAGGGGG - Intronic
1060858532 9:126934829-126934851 CTGGAAAGAAGAGAGGAGGGGGG - Intronic
1060920759 9:127418831-127418853 CTGGAAGGGACAGAGGAAAGAGG - Intergenic
1061081040 9:128370513-128370535 CTGGAACATGGAGAGGAAGGTGG - Intergenic
1061128262 9:128689910-128689932 AGGGAGGGGGGAGAGGAAGGGGG - Intronic
1061257309 9:129460324-129460346 CTGGAGGGGGGAGATGCAGGCGG - Intergenic
1061750948 9:132776626-132776648 ATGGAAGGGCTGGAGGATGGAGG + Intronic
1061855235 9:133438352-133438374 CTGGCAGAGCGAGAGGTAGGCGG + Exonic
1062051328 9:134448585-134448607 CTGGTAGTGAGAGTGGAAGGTGG + Intergenic
1062355913 9:136162206-136162228 ATGGAAGGGAGGGAGGGAGGGGG - Intergenic
1062449150 9:136608284-136608306 GAGGAAGGGAGGGAGGAAGGGGG + Intergenic
1062523680 9:136969863-136969885 CTGGCAGGGGGTGAGGATGGGGG - Intronic
1062600518 9:137316880-137316902 CTGGAAGGACCAGAGCAGGGTGG - Intronic
1185534069 X:845911-845933 CCCGGAGAGCGAGAGGAAGGAGG - Intergenic
1185992365 X:4905830-4905852 CTGGAGGGATTAGAGGAAGGAGG + Intergenic
1186269186 X:7866470-7866492 AAGGAAGGGAGAGAGGAAGGGGG - Intergenic
1186350103 X:8731830-8731852 CTGGAAGTGCTGGAAGAAGGCGG + Exonic
1186565138 X:10654430-10654452 CGGGATGGGTGGGAGGAAGGTGG + Intronic
1186925547 X:14329807-14329829 CTGAAAGGGAAAGAGGGAGGAGG - Intergenic
1187394513 X:18907831-18907853 TTGGAAGTGGAAGAGGAAGGGGG + Intronic
1187685002 X:21807323-21807345 GTGGGAGGGTGAGAGGAAGGGGG - Intergenic
1187809916 X:23164387-23164409 ATGGCAGTGCGAGAGGAGGGTGG + Intergenic
1188362648 X:29274872-29274894 TCAGAAGGGCGAGATGAAGGAGG - Intronic
1188740214 X:33769154-33769176 GAGGGAGGGAGAGAGGAAGGAGG + Intergenic
1188844979 X:35061270-35061292 CTGGAAGGGCAACTGGAGGGAGG + Intergenic
1189278619 X:39805203-39805225 CTGGAGGGGAGGGAGCAAGGAGG + Intergenic
1189434988 X:40984540-40984562 TTGGAAGAGGGAGGGGAAGGAGG + Intergenic
1189695742 X:43660070-43660092 CTGGAAGGGTGTGGGGCAGGAGG - Intronic
1190010253 X:46778520-46778542 CTGGAGGGGAAAGAGGGAGGAGG - Intergenic
1190071316 X:47282183-47282205 ATGGAAGGGAGAAAGGAAGGAGG - Intergenic
1190259810 X:48790776-48790798 GAGGAAGAGCGAGAGGAGGGAGG + Intronic
1190266783 X:48831653-48831675 CTGGGAAGGGGAGAGGGAGGCGG - Intronic
1190277497 X:48908355-48908377 TTGGGAGGCCGAGAGGCAGGTGG - Intronic
1190328508 X:49221383-49221405 CTGGAATGGAGTGAGGAAGGAGG - Intronic
1192102785 X:68282635-68282657 CTGAATGGGAGAGAGAAAGGTGG + Intronic
1192191003 X:68991119-68991141 AAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1192197505 X:69038389-69038411 CTGGGGGCGGGAGAGGAAGGAGG - Intergenic
1192819052 X:74624038-74624060 GTGGAAGGGAGAAAGGAAGAAGG - Intergenic
1193376380 X:80766778-80766800 CTCGGAGGGCGAGTGGAAGCAGG + Intronic
1193703906 X:84796692-84796714 TTTGAAGGGTGAGAGGAGGGAGG + Intergenic
1195384921 X:104305128-104305150 TTGGAAGGCCAAGAGGAAGAGGG - Intergenic
1195455458 X:105064272-105064294 GTGGAAGGGGGAGAGAAAAGTGG - Intronic
1197133278 X:123030916-123030938 CAGGAAGGGAGGGAGGGAGGGGG - Intergenic
1197289513 X:124638166-124638188 CTGGAAGAGAGAGAAGGAGGGGG + Intronic
1197710863 X:129666199-129666221 CTAGAGGAGCAAGAGGAAGGAGG - Intergenic
1198112407 X:133513514-133513536 CTGGAAAGGGAGGAGGAAGGAGG + Intergenic
1198743309 X:139863953-139863975 TTGGAAGGCTGAGAGGTAGGAGG + Intronic
1199617660 X:149670700-149670722 ATGGTGGGGAGAGAGGAAGGAGG - Intergenic
1199624983 X:149732549-149732571 ATGGTGGGGAGAGAGGAAGGAGG + Intergenic
1199871143 X:151900023-151900045 ATTGGAGGGTGAGAGGAAGGGGG - Intergenic
1200044515 X:153394046-153394068 GTGGAAGGGGGAGAGGGAGCAGG - Intergenic
1200095023 X:153654551-153654573 CTGGCAGGGGGAGGGGAAAGTGG - Intergenic
1200228236 X:154431205-154431227 TGGGAAGGGCCAGAGGAAGCTGG + Intronic
1200418225 Y:2935344-2935366 CTGGTAGGGCGGGCGGAGGGAGG - Intronic
1200787637 Y:7274031-7274053 CTGGATGGCTGCGAGGAAGGCGG - Intergenic