ID: 903241792

View in Genome Browser
Species Human (GRCh38)
Location 1:21987580-21987602
Sequence AAACTTGGTGCAGAACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 190}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903241792_903241794 -10 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241794 1:21987593-21987615 CACCAAGTTTGGCATCCATGTGG 0: 1
1: 1
2: 7
3: 68
4: 255
903241792_903241806 28 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241806 1:21987631-21987653 GGGGACCACCAGGTGGCCTAAGG 0: 2
1: 55
2: 125
3: 155
4: 302
903241792_903241803 18 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241803 1:21987621-21987643 TCCTGGGAGTGGGGACCACCAGG 0: 3
1: 4
2: 6
3: 29
4: 297
903241792_903241800 8 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG 0: 3
1: 12
2: 71
3: 114
4: 310
903241792_903241799 7 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241799 1:21987610-21987632 ATGTGGTGACCTCCTGGGAGTGG 0: 2
1: 25
2: 58
3: 68
4: 220
903241792_903241796 1 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241796 1:21987604-21987626 GCATCCATGTGGTGACCTCCTGG 0: 1
1: 3
2: 75
3: 94
4: 185
903241792_903241797 2 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241797 1:21987605-21987627 CATCCATGTGGTGACCTCCTGGG 0: 1
1: 4
2: 63
3: 141
4: 233
903241792_903241801 9 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241801 1:21987612-21987634 GTGGTGACCTCCTGGGAGTGGGG 0: 3
1: 11
2: 49
3: 98
4: 364
903241792_903241805 21 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903241792 Original CRISPR AAACTTGGTGCAGAACCAGA TGG (reversed) Intronic