ID: 903241795

View in Genome Browser
Species Human (GRCh38)
Location 1:21987595-21987617
Sequence CACCACATGGATGCCAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903241795_903241807 16 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241807 1:21987634-21987656 GACCACCAGGTGGCCTAAGGAGG 0: 2
1: 63
2: 133
3: 130
4: 208
903241795_903241800 -7 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG 0: 3
1: 12
2: 71
3: 114
4: 310
903241795_903241799 -8 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241799 1:21987610-21987632 ATGTGGTGACCTCCTGGGAGTGG 0: 2
1: 25
2: 58
3: 68
4: 220
903241795_903241803 3 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241803 1:21987621-21987643 TCCTGGGAGTGGGGACCACCAGG 0: 3
1: 4
2: 6
3: 29
4: 297
903241795_903241808 17 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241808 1:21987635-21987657 ACCACCAGGTGGCCTAAGGAGGG 0: 2
1: 80
2: 128
3: 129
4: 265
903241795_903241806 13 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241806 1:21987631-21987653 GGGGACCACCAGGTGGCCTAAGG 0: 2
1: 55
2: 125
3: 155
4: 302
903241795_903241805 6 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241795_903241801 -6 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241801 1:21987612-21987634 GTGGTGACCTCCTGGGAGTGGGG 0: 3
1: 11
2: 49
3: 98
4: 364
903241795_903241810 18 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241810 1:21987636-21987658 CCACCAGGTGGCCTAAGGAGGGG 0: 2
1: 82
2: 128
3: 129
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903241795 Original CRISPR CACCACATGGATGCCAAACT TGG (reversed) Intronic