ID: 903241798

View in Genome Browser
Species Human (GRCh38)
Location 1:21987608-21987630
Sequence ACTCCCAGGAGGTCACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 2, 1: 0, 2: 4, 3: 6, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903241798_903241806 0 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241806 1:21987631-21987653 GGGGACCACCAGGTGGCCTAAGG 0: 2
1: 55
2: 125
3: 155
4: 302
903241798_903241803 -10 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241803 1:21987621-21987643 TCCTGGGAGTGGGGACCACCAGG 0: 3
1: 4
2: 6
3: 29
4: 297
903241798_903241808 4 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241808 1:21987635-21987657 ACCACCAGGTGGCCTAAGGAGGG 0: 2
1: 80
2: 128
3: 129
4: 265
903241798_903241810 5 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241810 1:21987636-21987658 CCACCAGGTGGCCTAAGGAGGGG 0: 2
1: 82
2: 128
3: 129
4: 313
903241798_903241807 3 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241807 1:21987634-21987656 GACCACCAGGTGGCCTAAGGAGG 0: 2
1: 63
2: 133
3: 130
4: 208
903241798_903241805 -7 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241798_903241813 19 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241813 1:21987650-21987672 AAGGAGGGGTGAACTGTCCCAGG 0: 5
1: 29
2: 85
3: 116
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903241798 Original CRISPR ACTCCCAGGAGGTCACCACA TGG (reversed) Intronic