ID: 903241800

View in Genome Browser
Species Human (GRCh38)
Location 1:21987611-21987633
Sequence TGTGGTGACCTCCTGGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 3, 1: 12, 2: 71, 3: 114, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903241789_903241800 24 Left 903241789 1:21987564-21987586 CCATAGTGCGCTATACCCATCTG 0: 1
1: 1
2: 0
3: 1
4: 39
Right 903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG 0: 3
1: 12
2: 71
3: 114
4: 310
903241795_903241800 -7 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG 0: 3
1: 12
2: 71
3: 114
4: 310
903241791_903241800 9 Left 903241791 1:21987579-21987601 CCCATCTGGTTCTGCACCAAGTT 0: 1
1: 1
2: 0
3: 11
4: 87
Right 903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG 0: 3
1: 12
2: 71
3: 114
4: 310
903241792_903241800 8 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG 0: 3
1: 12
2: 71
3: 114
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903241800 Original CRISPR TGTGGTGACCTCCTGGGAGT GGG Intronic