ID: 903241805

View in Genome Browser
Species Human (GRCh38)
Location 1:21987624-21987646
Sequence TGGGAGTGGGGACCACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 2, 1: 0, 2: 2, 3: 28, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903241798_903241805 -7 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241795_903241805 6 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241792_903241805 21 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241791_903241805 22 Left 903241791 1:21987579-21987601 CCCATCTGGTTCTGCACCAAGTT 0: 1
1: 1
2: 0
3: 11
4: 87
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903241805 Original CRISPR TGGGAGTGGGGACCACCAGG TGG Intronic