ID: 903241805

View in Genome Browser
Species Human (GRCh38)
Location 1:21987624-21987646
Sequence TGGGAGTGGGGACCACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 2, 1: 0, 2: 2, 3: 28, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903241792_903241805 21 Left 903241792 1:21987580-21987602 CCATCTGGTTCTGCACCAAGTTT 0: 1
1: 1
2: 1
3: 18
4: 190
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241798_903241805 -7 Left 903241798 1:21987608-21987630 CCATGTGGTGACCTCCTGGGAGT 0: 2
1: 0
2: 4
3: 6
4: 131
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241795_903241805 6 Left 903241795 1:21987595-21987617 CCAAGTTTGGCATCCATGTGGTG 0: 1
1: 1
2: 2
3: 10
4: 97
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348
903241791_903241805 22 Left 903241791 1:21987579-21987601 CCCATCTGGTTCTGCACCAAGTT 0: 1
1: 1
2: 0
3: 11
4: 87
Right 903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG 0: 2
1: 0
2: 2
3: 28
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903241805 Original CRISPR TGGGAGTGGGGACCACCAGG TGG Intronic
901524532 1:9811595-9811617 TGGGGGTGGGGAGTAACAGGTGG - Intronic
901531913 1:9859112-9859134 TAGGAGTGGGGACCAGTTGGGGG - Intronic
901653385 1:10755677-10755699 TGGGGTTCGGCACCACCAGGTGG + Intronic
901657537 1:10778856-10778878 TGGGAGCAGAGACCTCCAGGCGG - Intronic
903016684 1:20366321-20366343 CGGGAGTGGGGACCGACGGGCGG - Intergenic
903028846 1:20448575-20448597 AGGGACTGGGGACCCTCAGGAGG + Intergenic
903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG + Intronic
903245313 1:22010793-22010815 TGGGAGTGGGGACCACCAGGTGG + Intronic
904495449 1:30884051-30884073 TGGGAGCCGGGACCAGGAGGGGG + Intronic
906149108 1:43577481-43577503 AGGGACTGGGAACCCCCAGGGGG - Intronic
906164804 1:43678257-43678279 TGGGTGTGGGAGTCACCAGGAGG + Intronic
906694223 1:47813330-47813352 TTGGAGGGGGCACCTCCAGGTGG + Intronic
907977770 1:59448858-59448880 TATGAGTGGGGAAGACCAGGAGG - Intronic
912658627 1:111509160-111509182 TGAGAATGGGGAAGACCAGGAGG + Intronic
912882412 1:113429408-113429430 TGGGAGTGGGCTCCAGGAGGTGG + Intronic
914997558 1:152558356-152558378 TGGGTGTGGAGACAACCATGAGG + Intronic
915348038 1:155207972-155207994 TTGGAGGGGGGGCCAGCAGGCGG + Intronic
915530685 1:156500655-156500677 TGGGCGCGGGGGCCAGCAGGCGG + Exonic
916773588 1:167936871-167936893 TGGGAGGGGAGACCACCGCGTGG - Exonic
918038870 1:180899978-180900000 TGGAGGTGGTGACCACCAGCAGG - Intergenic
918187791 1:182143333-182143355 TGGCAGTGGTGGCCACCAGAGGG + Intergenic
919491638 1:198212448-198212470 TGGGAGTGGGGATTAGCAGGCGG - Intronic
919689899 1:200519946-200519968 TGTTAGTGGGGACCATTAGGAGG + Intergenic
919805536 1:201379122-201379144 TGGGACTGAGGACCACCACAGGG + Intronic
920047066 1:203140232-203140254 TAGGATTGGGGAGCAGCAGGCGG + Intronic
922455134 1:225768285-225768307 AGGGAGTGGGGAAAACCAGGCGG + Intergenic
922754756 1:228089456-228089478 TGGGAGTGGGAACCATCACCAGG - Intronic
1063719632 10:8566856-8566878 TGGGAGTGGGGAACACTTGGAGG + Intergenic
1065978315 10:30863833-30863855 TGGAAGTGGAGAGCACAAGGTGG - Intronic
1066563152 10:36691990-36692012 TGCGACTGGGGACCACCAGGAGG - Intergenic
1067750534 10:48968508-48968530 AGGGAGTGGCCCCCACCAGGAGG + Intronic
1068565905 10:58575174-58575196 GGGGAGTGGGGGACAACAGGAGG - Intronic
1068793492 10:61052561-61052583 GGGGAGGGAGGAACACCAGGAGG - Intergenic
1069593605 10:69656487-69656509 GGGGAGTGGAGGCCACCAGGTGG + Intergenic
1069830401 10:71279227-71279249 TGGGAGAGGAGACCTGCAGGGGG + Intronic
1069835221 10:71303938-71303960 TGGGAATGGGGAGCACCTGTGGG + Intergenic
1070793332 10:79202726-79202748 TGGGAGCTGGGCCCAGCAGGTGG - Intronic
1070877205 10:79825822-79825844 GGTGGGTGGGGGCCACCAGGCGG + Intergenic
1070931712 10:80265813-80265835 TGGGAGTGGGGTCGGCCTGGTGG + Intergenic
1071415470 10:85437223-85437245 TGGGAGAAGGGAGCAGCAGGAGG - Intergenic
1071501279 10:86206012-86206034 TTGGAGAGGAGACCTCCAGGAGG + Intronic
1071643701 10:87341866-87341888 GGTGGGTGGGGGCCACCAGGCGG + Intergenic
1073251946 10:102125722-102125744 TAGGAGTTGGGACAAACAGGGGG - Intergenic
1073709591 10:106021759-106021781 TGGGACTGGGGACAGGCAGGAGG + Intergenic
1073755818 10:106579451-106579473 TTGGAGTGAGGTCCACCAGGGGG + Exonic
1074882407 10:117669234-117669256 TGGGAGCTGGGAACCCCAGGAGG + Intergenic
1075397964 10:122141431-122141453 TGGCAGTTGGGACCAACAGAAGG + Intronic
1075812200 10:125232444-125232466 AGAGAGTTGGGACCACCAGCAGG + Intergenic
1075963172 10:126586726-126586748 TGGGAGTGGGGAACAGCCAGAGG + Intronic
1076210027 10:128632761-128632783 TAGGACAGGGGACCACCTGGCGG + Intergenic
1076244288 10:128934042-128934064 CGGCAGTGGGGAGCACCAGCTGG + Intergenic
1076581242 10:131513404-131513426 TGGCTCTGGGGACCACCAGAGGG - Intergenic
1077185101 11:1232248-1232270 TGGGATTGGGGACCCCATGGAGG + Intronic
1077911654 11:6577167-6577189 GGGGAGTGGGGAGGAACAGGGGG + Intronic
1080692169 11:34567194-34567216 TGGGCACGGGGACCACCAGATGG - Intergenic
1081068599 11:38579962-38579984 TGGGAGTGGGGAGCAAGGGGAGG - Intergenic
1082822967 11:57557115-57557137 TGGAGGTGGGGCCTACCAGGAGG + Intronic
1083163636 11:60870571-60870593 TGGGAGTTGGGCTCTCCAGGAGG - Intronic
1083306376 11:61764125-61764147 TGGGGGTGGGGGTCAGCAGGAGG + Intronic
1083932755 11:65855002-65855024 TGGGAAGGGGGAGGACCAGGTGG + Exonic
1083946794 11:65928091-65928113 GGGGAGAGGGGACCCCGAGGAGG + Intergenic
1084673361 11:70620512-70620534 TGGGGGTGGGGGAGACCAGGCGG - Intronic
1084767196 11:71320327-71320349 CAGGAGGTGGGACCACCAGGGGG - Intergenic
1085278871 11:75317323-75317345 TGGGAGGGGAGAGCACCTGGAGG - Intronic
1085469048 11:76745189-76745211 TGGCAGTGAGGACTCCCAGGTGG + Intergenic
1085514243 11:77103130-77103152 TGGCAGTGGGGTCCAGCAGCTGG - Exonic
1086367711 11:86124603-86124625 TGGAAGTGGGGAAGCCCAGGAGG + Intergenic
1086929555 11:92677863-92677885 TGGGAGTGGGCTCCAGCAAGTGG + Intronic
1087735757 11:101831234-101831256 AGGCAGTGGGGACTACTAGGCGG + Intronic
1087819097 11:102690894-102690916 TGGGGGTGGGGACCAACTGTAGG + Intergenic
1090832203 11:130427734-130427756 GGAGAGAGGAGACCACCAGGAGG - Exonic
1091478557 12:801898-801920 TTTGAGTGATGACCACCAGGAGG + Intronic
1091768440 12:3136914-3136936 TGGCAGCTGGGACCACCTGGCGG - Intronic
1091775584 12:3182735-3182757 TGTGTGTTGGGACCACCAGGCGG + Intronic
1096448169 12:51713569-51713591 TCGGACTGGGGGCGACCAGGCGG + Intronic
1096897756 12:54840790-54840812 GGGGAGTGGGGAGTAGCAGGTGG + Intronic
1097042498 12:56164250-56164272 AGGGAGAGGGGTCCACCTGGAGG - Intronic
1097086636 12:56473534-56473556 TGACATTGGGTACCACCAGGAGG + Exonic
1098209518 12:68148883-68148905 TGGGAGTGAGAAACACCTGGGGG - Intergenic
1099142770 12:78999761-78999783 TGGGAGAGGGGACCATCACAAGG + Intronic
1099860832 12:88223312-88223334 TGGAGGTGGGGCCCAGCAGGAGG + Intergenic
1101882834 12:108637747-108637769 GGGGACTGGGGACCACCATGAGG - Intergenic
1101909152 12:108849840-108849862 TGGGGGAGGGGACCTCCAAGAGG + Intronic
1102056905 12:109903242-109903264 TGGAAGTGGGGACCACTTGCTGG + Intronic
1102645037 12:114398225-114398247 GGGGAGTGTGGATCACCGGGAGG + Intronic
1103840421 12:123859202-123859224 TGGTGGTGGGGCCCACCAGAGGG + Exonic
1103894925 12:124266637-124266659 TAAGAGTGGGGACCAGGAGGCGG + Intronic
1103915315 12:124372880-124372902 CGGGGGTGCTGACCACCAGGAGG - Intronic
1104231907 12:126893112-126893134 TGGGGGTGGGGAACAAAAGGAGG + Intergenic
1104602835 12:130164477-130164499 TGGTGGTGGGGATCACCAGCGGG + Exonic
1104760345 12:131294225-131294247 AGGGACTGGGGCCCAGCAGGTGG + Intergenic
1104760509 12:131295244-131295266 TGTGACTGGGGACCCCCAGGGGG - Intergenic
1104819266 12:131665541-131665563 TGTGACTGGGGACCCCCAGGGGG + Intergenic
1104819422 12:131666422-131666444 AGGGACTGGGGCCCAGCAGGTGG - Intergenic
1105497492 13:20943729-20943751 TGGGGGTGGGAGCCACCTGGTGG - Intergenic
1105582745 13:21715902-21715924 TGGGAGAAGGGATCACCAAGAGG + Intergenic
1106011471 13:25828023-25828045 CGGGAATGTGGACCACCAGCTGG - Intronic
1107714007 13:43180646-43180668 TGGGTGGGGGGAACATCAGGGGG - Intergenic
1108125580 13:47239219-47239241 TGGGAGTAGGAACATCCAGGTGG + Intergenic
1110356786 13:74575974-74575996 TGGGAGTGGGGACAGCGAGGGGG + Intergenic
1112186390 13:97132014-97132036 TGGAAATTGGGACCACCAGGAGG + Intergenic
1112237433 13:97649038-97649060 GGGGAGAGGGAACCAACAGGGGG - Intergenic
1113956566 13:114102658-114102680 TGGGACTGCAGCCCACCAGGTGG + Intronic
1114413840 14:22525822-22525844 AGGGACTGGGGTCCTCCAGGAGG - Intergenic
1114818438 14:25987326-25987348 TAGCAGTTGGGACCAGCAGGGGG - Intergenic
1115534349 14:34358511-34358533 TGGAAGTGGGGCCTAGCAGGAGG + Intronic
1117258276 14:54002638-54002660 TGGGAGTGGGGACAAATGGGAGG - Intergenic
1119748135 14:77059039-77059061 TGGAAGTGGGGAGAACCATGAGG - Intergenic
1121255158 14:92525558-92525580 AGGGAATGGGGCCCACTAGGAGG + Intronic
1122074730 14:99228769-99228791 AGGGAGTGGGGACCTGCAGAAGG - Intronic
1122137711 14:99644570-99644592 TGGAAGTGGGGAGCCCCAGTGGG + Intergenic
1123097679 14:105774155-105774177 TGGGAGGCAGGACCAGCAGGGGG - Intergenic
1123499399 15:20866483-20866505 TGGGCGTGGGGTCCCCCTGGTGG - Intergenic
1123556651 15:21440213-21440235 TGGGCGTGGGGTCCCCCTGGTGG - Exonic
1123592873 15:21877448-21877470 TGGGCGTGGGGTCCCCCTGGTGG - Intergenic
1123804896 15:23860662-23860684 TGGGAGGGGGGATCAGGAGGGGG + Intergenic
1127492295 15:59476536-59476558 TGGGTGTGGGATCCACAAGGTGG + Intronic
1127779509 15:62298973-62298995 TGAGAGTGGGGCCCAGCAGTTGG + Intergenic
1128246161 15:66134267-66134289 TGGGAGTTGGGGCGAGCAGGAGG - Intronic
1129235290 15:74220088-74220110 AGGCAGTGGGGAACACCAGAGGG + Intergenic
1129322809 15:74783967-74783989 TGAGAGTGGGGACACCCAGGGGG + Intronic
1129472477 15:75763264-75763286 TGGGAGTGGGGCTCCCCACGTGG - Intergenic
1130210425 15:81917184-81917206 TTGGAGTGGGGACCTCCCTGGGG - Intergenic
1130970168 15:88726139-88726161 TGGGAATTTGGACGACCAGGTGG - Intergenic
1131149393 15:90037335-90037357 TGGGACTGGGAATCCCCAGGAGG + Intronic
1131552065 15:93365639-93365661 TGGGAGTGGGGATCAGCTGAAGG + Intergenic
1131648688 15:94375287-94375309 TGGAGGTGGGGCCCAGCAGGAGG - Intronic
1202964990 15_KI270727v1_random:167402-167424 TGGGCGTGGGGTCCCCCTGGTGG - Intergenic
1132623916 16:881088-881110 TGGAAGTCGGGGCCCCCAGGTGG + Intronic
1132683371 16:1152825-1152847 CGGGCGTGGGGTGCACCAGGGGG - Intergenic
1132939915 16:2501485-2501507 AGGGGGTGGGGTCCGCCAGGGGG - Exonic
1133078774 16:3301878-3301900 TGGCTTTGGGGAGCACCAGGAGG - Exonic
1133222575 16:4325109-4325131 GGGGTGGGGGGCCCACCAGGAGG - Intronic
1134489710 16:14687552-14687574 TGGGGGTGGGGACCAGAAGGAGG - Intronic
1135381427 16:21999365-21999387 TGTGTTTGGGGACAACCAGGTGG + Intronic
1136567957 16:31081202-31081224 CGGGACTGGGGAGGACCAGGTGG + Exonic
1136717301 16:32290661-32290683 GGGGAGTGGGGACCCAGAGGTGG + Intergenic
1136835676 16:33496915-33496937 GGGGAGTGGGGACCCAGAGGTGG + Intergenic
1137000161 16:35222222-35222244 AGGGAGTGGAGAGGACCAGGCGG - Intergenic
1137004056 16:35255842-35255864 AGGGAGTGGAGAGGACCAGGAGG - Intergenic
1137019936 16:35414905-35414927 AGGGAGTGGAGAGGACCAGGTGG - Intergenic
1137021442 16:35432262-35432284 TGCTAGTGCGGGCCACCAGGCGG - Intergenic
1138376071 16:56564938-56564960 TGGGAGTTGGGAAGAGCAGGCGG - Intergenic
1138977018 16:62220343-62220365 TGGGGGTGAGGACCAGCAGTGGG - Intergenic
1139957575 16:70700423-70700445 TGGTAGTTGGGGACACCAGGCGG - Intronic
1139973289 16:70789876-70789898 TGGGAGTGGGGACATCCTCGAGG + Intronic
1140750194 16:78016443-78016465 TGGGGGTGCGGCCCACCTGGTGG - Intergenic
1141147824 16:81544033-81544055 TGGGAATGGGTACCCCAAGGAGG - Intronic
1142258986 16:89033619-89033641 TGGCAGTGAGGAGCAGCAGGAGG + Intergenic
1203009128 16_KI270728v1_random:227117-227139 GGGGAGTGGGGACCCAGAGGTGG - Intergenic
1143327838 17:6111113-6111135 TGTGGATGGGGACCACCAGGCGG - Intronic
1144312483 17:14025503-14025525 TGGGTGAGGGGACCAGGAGGTGG + Intergenic
1144332269 17:14235822-14235844 TGGGTGAGGGGACCAGGAGGTGG - Exonic
1144958665 17:19032749-19032771 TGGGAATGGCGTCCGCCAGGCGG - Intronic
1144976494 17:19141775-19141797 TGGGAATGGCGTCCGCCAGGCGG + Intronic
1145207513 17:20992504-20992526 AGGAAGTGGGGACCACCACGGGG + Intergenic
1147164432 17:38585942-38585964 AGGGAGTGGGGATCACCGTGGGG - Intronic
1147374077 17:40013889-40013911 TGCCATTGGTGACCACCAGGGGG + Intergenic
1147915341 17:43882268-43882290 TGGGTGAGGGGCCCACCTGGCGG + Exonic
1148178456 17:45586559-45586581 TGGCTGTGGGGACCACAAGGAGG - Intergenic
1148225010 17:45893316-45893338 TAGGAGTGAGAACCACCATGGGG - Intergenic
1148270704 17:46259896-46259918 TGGCTGTGGGGACCGCAAGGAGG + Intergenic
1148691327 17:49528511-49528533 GGGGAGGGGGGACCAGGAGGTGG + Intergenic
1151966007 17:77432039-77432061 TGGGGGTGGGGGGCAGCAGGGGG + Intronic
1152073310 17:78144724-78144746 TGGGAGAGGGGGCCACCGAGGGG + Intergenic
1152291141 17:79440866-79440888 GGGGTGTGGGGAAGACCAGGAGG - Intronic
1152328892 17:79659123-79659145 AGGGAGTGTGGACCACGCGGGGG + Intergenic
1152528061 17:80900899-80900921 TGGGCGTGGGGACCTGCAGACGG - Intronic
1152594735 17:81232651-81232673 AGGGCCTGGGGCCCACCAGGAGG - Intronic
1152693353 17:81731907-81731929 TGGGAGTGGGGAGCACCGCCTGG - Intergenic
1153028216 18:690028-690050 TGGGAGTGTGGCTCACCTGGAGG + Intronic
1154293092 18:13127556-13127578 TGGGAGTGGGGAGAAACAGCTGG - Intergenic
1156036447 18:32771517-32771539 GGGGAGAGGGGGCCACCGGGTGG - Intronic
1158152466 18:54387963-54387985 TTGGAGTTGGGACCAACAGGCGG - Intergenic
1161262422 19:3345300-3345322 TGGGAGTGGGAGCATCCAGGCGG - Intergenic
1161342941 19:3752774-3752796 CGGGTGTGGGGGGCACCAGGTGG + Intronic
1162726846 19:12695054-12695076 TGGGAGTAGGGATCTCCATGGGG - Intronic
1163234764 19:16023862-16023884 TGGTACTGGGGCCCACCTGGGGG - Intergenic
1163472553 19:17505853-17505875 TCGGAGGGGCCACCACCAGGTGG - Exonic
1163700811 19:18785649-18785671 TGGGAGCGGGGTCCACGTGGGGG - Intronic
1164841735 19:31397956-31397978 TGGAAGTGGGGCCTACCGGGAGG + Intergenic
1165909760 19:39218134-39218156 TGGGAGAGGGGACTTCCAGTAGG + Intergenic
1166072168 19:40394061-40394083 TGGGAGTGGGGACCAGGAAGAGG - Exonic
1166109353 19:40613091-40613113 TGGCCGTGGGGACCACAGGGAGG - Exonic
1166391539 19:42411395-42411417 TGAGAATGGGGACCAACTGGAGG - Intronic
1166568130 19:43777571-43777593 TGGCAGTGGGGAGCTGCAGGGGG - Intronic
1167456995 19:49601603-49601625 TGGGCGTGGGGGCCACCAGCGGG - Exonic
1167575865 19:50317122-50317144 TGGGAGTGGGTGCAAGCAGGGGG + Intronic
1168110064 19:54187202-54187224 TGGGAGTGGGCAGGCCCAGGAGG + Exonic
1168593375 19:57654655-57654677 AGGGATTGGGGGCCACCAGATGG - Intergenic
925341689 2:3142440-3142462 TGAGAGTGGGGCCCACCTGCAGG - Intergenic
925425370 2:3744797-3744819 TGGCAGTGGCGACGAGCAGGTGG + Intronic
926049887 2:9737803-9737825 TGGAAGTGGGGGGCACTAGGAGG - Intergenic
926393341 2:12416745-12416767 TGGAAGTGGGTGCCAGCAGGGGG + Intergenic
926703212 2:15818078-15818100 TGGGAGACGGGAGCCCCAGGAGG + Intergenic
928155290 2:28870816-28870838 TGGGTGAGGGGACCGGCAGGTGG - Intergenic
928670608 2:33599502-33599524 TGGGCGTGGGGACCACGCGAAGG + Intergenic
930206291 2:48589362-48589384 TCGCAGTGCTGACCACCAGGGGG - Intronic
932288863 2:70558379-70558401 TGGGACTCAGGGCCACCAGGTGG + Intergenic
932522359 2:72427443-72427465 TGGGAGTGGGCACCAGGAGTGGG - Intronic
933835329 2:86241097-86241119 GGGGAGTCAGGGCCACCAGGAGG + Intronic
934765998 2:96880359-96880381 AGGGAGTGGGGACAACCTGGGGG + Intronic
935461986 2:103347469-103347491 TGGGAGTGAGAAGCTCCAGGGGG - Intergenic
935947890 2:108302475-108302497 TGGCTGTGGGGACCACCTTGTGG - Intronic
936533540 2:113293222-113293244 TGGGACTGGGGAACACCATCAGG + Intergenic
937265928 2:120614707-120614729 TGGCAGTGGGGAGAGCCAGGAGG - Intergenic
938018210 2:127885434-127885456 GGTGGGTGGGGGCCACCAGGCGG + Intronic
938286345 2:130120723-130120745 TGGGCGTGGGGTCGCCCAGGGGG - Intronic
938429262 2:131218173-131218195 TGGGCGTGGGGTCGCCCAGGGGG + Exonic
940014388 2:149088084-149088106 TGGGTGGGGGGAGCAACAGGAGG - Intronic
947137034 2:226985709-226985731 TGGGTGTGTGAATCACCAGGAGG - Intronic
947330968 2:229029055-229029077 AGACACTGGGGACCACCAGGAGG + Intronic
947723416 2:232382260-232382282 CTGGGGTGGGGATCACCAGGGGG + Exonic
947727128 2:232407854-232407876 TGGGAGTGGTAACCACCACACGG + Exonic
947736292 2:232457159-232457181 TAGGAGTGGTGACCACCACACGG + Exonic
947825078 2:233100365-233100387 TGGGCCTGGGAACCAGCAGGAGG - Intronic
948411123 2:237761941-237761963 AGGGAGAGAGGACCAGCAGGAGG - Intronic
948813755 2:240499398-240499420 TGGGGGTGGGGGTGACCAGGTGG + Intronic
1169897308 20:10518006-10518028 TGGGAGTGGGGAGGGGCAGGGGG + Intronic
1170463036 20:16596875-16596897 TGGGAGATGGGGCCACCAGGAGG - Intergenic
1171406054 20:24913120-24913142 TGGGAGGCAGCACCACCAGGCGG + Intergenic
1171451256 20:25237586-25237608 TGGGTGTGGGGAGGGCCAGGAGG + Intergenic
1172126254 20:32626939-32626961 GGTGTGTGGGGGCCACCAGGTGG + Intergenic
1172906139 20:38370883-38370905 TGGGAGGGGGGGCCACCATTTGG + Intronic
1173248562 20:41352522-41352544 GCAGAGTGGGGAGCACCAGGGGG + Intronic
1173537829 20:43829476-43829498 TGGAGGTGGGGACCACATGGTGG + Intergenic
1173752356 20:45487402-45487424 TGGACGTGGGGGCCACCAGCGGG - Intergenic
1173988351 20:47280240-47280262 TGGGAGAGGGGATCCCCTGGAGG - Intronic
1174255748 20:49253665-49253687 TTTGATTGGGGACCACCAGCAGG - Exonic
1174531177 20:51215535-51215557 TGGCAGTGGGGAGGACCAGTGGG - Intergenic
1175107223 20:56624199-56624221 TGGGAGAGGTTACCAGCAGGTGG + Intergenic
1175387763 20:58608262-58608284 TGGGAGTGAGGACCGAGAGGTGG + Intergenic
1175391798 20:58632187-58632209 GAGGCGTGAGGACCACCAGGAGG + Intergenic
1175697427 20:61113101-61113123 TGGGAGGGGGCACCACAAGGAGG + Intergenic
1176093393 20:63328833-63328855 CGGGAGTGGGGAGGACAAGGAGG - Intronic
1176164177 20:63664290-63664312 TGGGACTGGGGACACCCAGCAGG - Intronic
1176197662 20:63844782-63844804 TTGGACTGGGGTCCCCCAGGAGG - Intergenic
1177724906 21:24954949-24954971 TGGGAGGGTGGATCACAAGGCGG + Intergenic
1178842287 21:36147359-36147381 TGGGCATCGGGACCACCTGGAGG + Intergenic
1179644427 21:42766942-42766964 TGGGAGTGGGGACCTTCAGCTGG - Intronic
1180205071 21:46254726-46254748 GGGGAACGGGGATCACCAGGGGG + Intronic
1181500591 22:23313594-23313616 GGGGAGTGAGGAACACAAGGAGG - Intronic
1182491431 22:30674788-30674810 GGGGAGTGGGGACCACTGGAAGG - Intergenic
1183276425 22:36900950-36900972 TGGGGGTCAGGAGCACCAGGGGG - Intergenic
1183772488 22:39938821-39938843 TGGGAGTGGGGAGCGCCCTGGGG + Intronic
1183909014 22:41064606-41064628 TGGGGCTGGAGACCACAAGGAGG + Intergenic
1184405636 22:44298936-44298958 TGGGAGCCGGGACAACCGGGTGG + Intronic
1184416620 22:44355589-44355611 GGGGAGTGGGAAGCATCAGGAGG - Intergenic
1184839316 22:47043316-47043338 AGGGTGTGGGGAGCAGCAGGTGG + Intronic
1184879745 22:47297316-47297338 TGGGAGTGAGGTCCTCCACGCGG - Intergenic
950625639 3:14244698-14244720 TGGGCGTGGAGAGCAGCAGGTGG + Intergenic
953043237 3:39273311-39273333 TGGCAGTGTGGACCACCTAGTGG - Intronic
953923544 3:46968400-46968422 TGTAAGTGGGGACATCCAGGTGG - Intronic
954861455 3:53694305-53694327 TGGGAGTGAGGGACAGCAGGTGG + Intronic
955386836 3:58487283-58487305 AGGGAACGGGGAACACCAGGAGG + Intergenic
955494657 3:59519142-59519164 TGGGAGTGGGCCCCAGCAAGCGG + Intergenic
956362084 3:68459228-68459250 GGGGAGTGGGGAGGATCAGGTGG + Intronic
959293274 3:104502029-104502051 TGGGAGTGGGGCCTAGTAGGAGG - Intergenic
960870073 3:122239297-122239319 TGGTGGTGGTGGCCACCAGGAGG + Intronic
961318155 3:126054753-126054775 AGGGAGTGGAGGCCACAAGGAGG - Intronic
961450345 3:126999693-126999715 TGGGAGTGGGTACAGCCAGCAGG + Intronic
963432659 3:145229715-145229737 TGAGAGTGTGAACCACGAGGAGG - Intergenic
963785025 3:149525761-149525783 TGGGAGTGGGGAGGAACAAGGGG + Intronic
964928329 3:161983527-161983549 TGAGAGTGCAGACAACCAGGTGG - Intergenic
965090563 3:164157614-164157636 AGGGTGTGGGGTCCAACAGGAGG - Intergenic
965380393 3:167981065-167981087 TGGGAGAGGGGAGAACCAGATGG + Intergenic
967402488 3:189079277-189079299 TGGAGGTGGGGAACACCTGGTGG - Intronic
968660925 4:1798374-1798396 GGGGAGTGGGGAGGCCCAGGCGG - Intronic
968812613 4:2806748-2806770 TGGGAGTCGGGACTGCCCGGGGG - Intronic
969708775 4:8830908-8830930 TGGGAAAGGTGACCACCAAGAGG - Intergenic
972663876 4:41145154-41145176 TGTGAGTAGGTAACACCAGGAGG - Intronic
974606473 4:64157978-64158000 TTGGAGGTGGGACCACCTGGTGG - Intergenic
975154154 4:71052573-71052595 TGGGAGGTGGGCCCACCAGGAGG - Intergenic
975689317 4:76949283-76949305 AGGGGCTGCGGACCACCAGGCGG - Intergenic
980753538 4:137125216-137125238 GGGGGTTGGGGACCAGCAGGAGG + Intergenic
980926672 4:139144710-139144732 AGGGAGTGGGGAGTAGCAGGTGG - Intronic
982681833 4:158440813-158440835 TGGAGGTGGGGACTAGCAGGAGG + Intronic
984159128 4:176229919-176229941 TGGGAGTGGAGAGCAGAAGGAGG + Intronic
984699201 4:182807637-182807659 TGGGAGCCGGGATGACCAGGAGG + Intergenic
984725222 4:183013729-183013751 AGGAAGTGGGGATCACCAAGGGG + Intergenic
985657031 5:1137595-1137617 CATGAGTGGGGACCACCCGGAGG - Intergenic
986025873 5:3850365-3850387 TGGGAATGGGGATGACCAGTAGG + Intergenic
988813157 5:34805369-34805391 TAGGAGTGGGGGGCAGCAGGAGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
993022175 5:82605210-82605232 TGGGAATGTGGACTGCCAGGGGG - Intergenic
994937243 5:106271050-106271072 TGGGAGTGGGGACGAAGAAGAGG + Intergenic
997386207 5:133474884-133474906 TGGGTGTTGGGAGCACCGGGAGG - Intronic
998012926 5:138709615-138709637 TGGGGGTGGGGGCCACCTGCTGG + Intronic
998386618 5:141760756-141760778 ATGGAGAGGGGTCCACCAGGCGG + Intergenic
998456533 5:142278149-142278171 AGGGAGTGGGGAAAAACAGGTGG + Intergenic
999304592 5:150511518-150511540 TGAGAGTGGGGCACACCAGACGG + Intronic
1000064128 5:157680616-157680638 AGGGAGTGGGGACCACTGGAAGG - Intergenic
1001016906 5:168150036-168150058 AGGGGGAGGGGACCACAAGGGGG - Intronic
1001288360 5:170439511-170439533 TGGCAGCTGAGACCACCAGGTGG - Intronic
1001485570 5:172117382-172117404 TGGGAGTGTGGACCTCATGGGGG - Intronic
1002064237 5:176644126-176644148 CTGGAGGGGGGAGCACCAGGGGG + Intronic
1002644208 5:180645277-180645299 TGGGGGTGGAGACCAGGAGGAGG + Intronic
1002680573 5:180959780-180959802 AGGGAGTGGGGAGTAGCAGGTGG + Intergenic
1002856937 6:1046292-1046314 CGGGAGTGGGGCGCACCAGGTGG - Intergenic
1003016705 6:2473898-2473920 GGGGAGTGGGGGACCCCAGGGGG - Intergenic
1003112501 6:3261503-3261525 TGGGAGCTGTGACCACCATGGGG - Intronic
1006449833 6:34099497-34099519 AGAGAGTGGGGACTAGCAGGGGG + Intronic
1007193016 6:40036106-40036128 TGGGAGTTGGGACCTCTGGGAGG - Intergenic
1007637510 6:43308168-43308190 CTGGTGTGGGGTCCACCAGGTGG + Intronic
1007916127 6:45563221-45563243 TGGCAGTGGGGGGCACCAGAAGG - Intronic
1010325671 6:74559293-74559315 TTGGAATGGGGACCTGCAGGAGG - Intergenic
1016945620 6:149529993-149530015 TGGGGGTGGGGATGAACAGGTGG + Intronic
1017557656 6:155589355-155589377 TGGGAGTGAGAACAGCCAGGAGG + Intergenic
1017568508 6:155714927-155714949 TGGGAGTAGGGAGCAACAGAAGG - Intergenic
1018195979 6:161356409-161356431 TGTCAGTGGGGACCCCCGGGGGG + Intronic
1018631567 6:165826774-165826796 TGGGAGGGGGGACGCACAGGGGG + Intronic
1018893735 6:167999879-167999901 TGGGAGTGGGGATTTCCAGGGGG - Intronic
1019299228 7:295234-295256 TGGGAGAGAGGGGCACCAGGCGG + Intergenic
1019499960 7:1359919-1359941 TGGGTGTGGGGCCCACCAGGAGG + Intergenic
1019529783 7:1497573-1497595 TGGGGGTGCGGGACACCAGGCGG + Intronic
1022517883 7:30987340-30987362 TGGGGGTGGGCGCCAACAGGGGG + Intronic
1022529835 7:31059946-31059968 TGGGTGTGGGGACCAAGAGAAGG + Intronic
1023864628 7:44232920-44232942 AGGAAGCGGAGACCACCAGGAGG + Intronic
1024409246 7:49020291-49020313 TAGGAGTGGGGAGCAGGAGGAGG + Intergenic
1024678334 7:51658272-51658294 TGGGAATGGTGCCCAGCAGGTGG - Intergenic
1025026982 7:55524748-55524770 TGGGAATGGAGACCAGGAGGTGG + Intronic
1025615466 7:63113438-63113460 TTGGTGTGGGGACCAGCCGGGGG + Intergenic
1026612379 7:71871619-71871641 TGGGAGTGGGGGCAGGCAGGAGG - Intronic
1027265458 7:76492846-76492868 TGGGTGTGGGGGCCAGCAGTAGG - Intronic
1027316829 7:76990963-76990985 TGGGTGTGGGGGCCAGCAGTAGG - Intergenic
1029028493 7:97443651-97443673 TTGGAGTGGGGACCTGAAGGAGG - Intergenic
1029124985 7:98289455-98289477 TGGGAGTAGGGTCCCCCAGATGG + Intronic
1029547172 7:101216651-101216673 TGGGAGGGGGTCCCAGCAGGAGG - Intronic
1030099426 7:105932431-105932453 TGGGAATGGGCACAACCAGGTGG + Intronic
1032653573 7:133904578-133904600 TGACAGTGGGCACCAACAGGTGG - Intronic
1034460109 7:151193425-151193447 TGCCAGAGGGGCCCACCAGGAGG + Exonic
1034893552 7:154860486-154860508 TGAGAGTCTGGACCAGCAGGGGG + Intronic
1035699510 8:1627317-1627339 TGGGAGTGGGGCCGACCGGCAGG - Intronic
1036135856 8:6160981-6161003 TGGGAGAGGGGAGCAGGAGGTGG - Intergenic
1037932375 8:22889292-22889314 TGGGAGTGAGAAACAGCAGGAGG + Intronic
1039385101 8:37128714-37128736 AGGGAATGGGGAGTACCAGGAGG + Intergenic
1039879394 8:41615092-41615114 TGTGAGTGGGGTGCAGCAGGAGG + Intronic
1042346516 8:67733266-67733288 TGGGGGTGGGGCCCAGCAGTCGG - Intronic
1044726894 8:95201583-95201605 AGGGAGTGGGGATCAGGAGGTGG + Intergenic
1045159816 8:99526110-99526132 TGGGGATGGGGATCACCAGCAGG + Intronic
1046559980 8:115824006-115824028 AGGGAGTGGGGAGCTTCAGGGGG + Intergenic
1048498788 8:134957510-134957532 TGGGAGTGTGCACCTCCAAGTGG + Intergenic
1049411557 8:142475909-142475931 TGGGAGTGGGGCCTAGCCGGGGG + Intronic
1049523269 8:143106069-143106091 GGGGGGTGGGGAGCAACAGGAGG + Intergenic
1049724823 8:144140875-144140897 TGGGAGTGAGCGCCTCCAGGAGG - Intergenic
1049843712 8:144789749-144789771 TGGGGGTGGGCACAGCCAGGTGG + Exonic
1050476477 9:6046107-6046129 GGGGAGTGGGGAGCAGCAGGTGG + Intergenic
1053128105 9:35599187-35599209 TTGGAGTGGGCACCAACAGCAGG - Intergenic
1056106294 9:83349856-83349878 GGGGAGTGGGGGCCAGGAGGGGG + Intronic
1056425032 9:86467280-86467302 TGGAAATGGGGACCACCAATGGG + Intergenic
1057332628 9:94129770-94129792 TGGAAGTGGGGCCTAGCAGGAGG + Intergenic
1058916027 9:109566506-109566528 TGGGAGTGGGGATGACATGGAGG - Intergenic
1060050633 9:120375980-120376002 TGGGAGTGGGGGCCACATAGTGG - Intergenic
1060509566 9:124222240-124222262 TGGGAGTGGGGAGGCCAAGGTGG - Intergenic
1060561578 9:124549328-124549350 TGTGAGTGGGGAACACCAAATGG + Intronic
1060985661 9:127817667-127817689 TGAGAGTGGGGGTCACCAGATGG + Intronic
1061088540 9:128413161-128413183 TTGGACTGGGAACCAGCAGGCGG - Intronic
1061137108 9:128741316-128741338 TGGGAGTGGGGGCTCTCAGGAGG + Intronic
1061811964 9:133167416-133167438 TGGGGGTGGGCAGCAGCAGGAGG + Intergenic
1061890478 9:133616704-133616726 CTGGAGTTGGGAGCACCAGGAGG - Intergenic
1061948486 9:133922057-133922079 TGGGCTTGGGGTCCAGCAGGCGG - Intronic
1061989218 9:134149144-134149166 TTGGCGTGGGGATCCCCAGGGGG + Intronic
1062097610 9:134711035-134711057 TGGGGGAGGGGACCACTTGGGGG + Intronic
1062221992 9:135421398-135421420 GAGCAGTGAGGACCACCAGGGGG - Intergenic
1062287042 9:135777938-135777960 TGGGAGTGGGGAGGAGCTGGTGG - Intronic
1062518480 9:136947604-136947626 TGGGCCCTGGGACCACCAGGTGG + Intronic
1186850648 X:13576397-13576419 TGGAGGTGGGGCCCAGCAGGAGG - Intronic
1187013985 X:15308080-15308102 TGGGAGTGGGGAGAAACAAGAGG + Intronic
1188790701 X:34404979-34405001 AGGGAGTGGGGAGTAGCAGGAGG + Intergenic
1189228464 X:39433241-39433263 GGGGAGTTGTCACCACCAGGAGG - Intergenic
1189283258 X:39833953-39833975 AGAGAGTGGGGCCCCCCAGGTGG - Intergenic
1192659615 X:73028983-73029005 TGGGAATTTGGACCACCCGGGGG - Intergenic
1192981594 X:76350335-76350357 AGGGAGTGGGGAGTAGCAGGTGG - Intergenic
1193386859 X:80883138-80883160 AGGGAGTGGCGAGTACCAGGTGG - Intergenic
1194268054 X:91779183-91779205 AGGGAGTGGGGACCAGAGGGGGG + Intergenic
1194337443 X:92665596-92665618 AGGGAGTGGGGAGTAGCAGGTGG - Intergenic
1200246952 X:154531516-154531538 TGGGACAGGGGACATCCAGGGGG + Exonic
1200585257 Y:5000104-5000126 AGGGAGTGGGGACCAGAGGGGGG + Intergenic
1200645864 Y:5782330-5782352 AGGGAGTGGGGAGTAGCAGGTGG - Intergenic
1202048508 Y:20757674-20757696 TGGGAGTGGCCACCAGCGGGTGG - Intronic