ID: 903249385

View in Genome Browser
Species Human (GRCh38)
Location 1:22041533-22041555
Sequence ATTGGGAGAGGGCCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903249385_903249395 30 Left 903249385 1:22041533-22041555 CCTTCCTCAGGCCCTCTCCCAAT No data
Right 903249395 1:22041586-22041608 GTTGTCTGTTTCTGAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903249385 Original CRISPR ATTGGGAGAGGGCCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr