ID: 903251237

View in Genome Browser
Species Human (GRCh38)
Location 1:22054300-22054322
Sequence GCTCACTTGACCCCGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76038
Summary {0: 1, 1: 7, 2: 555, 3: 13767, 4: 61708}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903251237_903251244 5 Left 903251237 1:22054300-22054322 CCGCCTCCCGGGGTCAAGTGAGC 0: 1
1: 7
2: 555
3: 13767
4: 61708
Right 903251244 1:22054328-22054350 ACCTCAGCCTCCCGAGTAGCTGG 0: 6311
1: 132274
2: 300665
3: 217345
4: 143708
903251237_903251247 14 Left 903251237 1:22054300-22054322 CCGCCTCCCGGGGTCAAGTGAGC 0: 1
1: 7
2: 555
3: 13767
4: 61708
Right 903251247 1:22054337-22054359 TCCCGAGTAGCTGGTACTGCAGG 0: 10
1: 1920
2: 64223
3: 191415
4: 274745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903251237 Original CRISPR GCTCACTTGACCCCGGGAGG CGG (reversed) Intronic
Too many off-targets to display for this crispr