ID: 903252431

View in Genome Browser
Species Human (GRCh38)
Location 1:22065592-22065614
Sequence GGTAATGTATATAAAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903252431_903252432 -6 Left 903252431 1:22065592-22065614 CCAGTTGCTTTATATACATTACC 0: 1
1: 0
2: 6
3: 36
4: 319
Right 903252432 1:22065609-22065631 ATTACCTCATTTCTCTGTAGTGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903252431 Original CRISPR GGTAATGTATATAAAGCAAC TGG (reversed) Intronic
903252431 1:22065592-22065614 GGTAATGTATATAAAGCAACTGG - Intronic
903770557 1:25761154-25761176 GATAATGTATATAACGGATCTGG + Intronic
903957895 1:27037706-27037728 GGTAATGCAAATAAAGAATCTGG - Intergenic
906823582 1:48954913-48954935 GATAATGTATATATAGCATATGG + Intronic
907549377 1:55291449-55291471 GATAATGAATATAAAGCATGTGG + Intergenic
908009841 1:59764786-59764808 GATAATGCATATAAAGCACTCGG + Intronic
909003577 1:70248678-70248700 AGTACATTATATAAAGCAACAGG - Intronic
909474001 1:76062006-76062028 AGTAATGTAGATAAAACAATAGG - Intergenic
910245859 1:85137183-85137205 GACAATGTATATAAAGCACCTGG + Intergenic
911261221 1:95688695-95688717 GCTAATGCTTAAAAAGCAACTGG - Intergenic
915642339 1:157238421-157238443 AATAATGCATATAAAGCCACAGG + Intergenic
915742890 1:158132820-158132842 GGAAATGTACAGAAAGCAGCAGG - Intergenic
915746382 1:158162508-158162530 GATAATGTGTATAAATCACCTGG - Intergenic
916866688 1:168867418-168867440 GATAGAGTATATAAAGCATCTGG + Intergenic
919419252 1:197350878-197350900 AGTAATGTATATAAAACTCCTGG + Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
920372931 1:205491089-205491111 GATAATGCATATAAAACATCTGG - Intergenic
920600325 1:207318576-207318598 TATAATGTGTATAAAGCAACTGG + Intergenic
921153574 1:212420599-212420621 GGTGTTGTATGTAAAGCCACAGG - Intergenic
921778372 1:219129809-219129831 GGTAAAGTATATAGAGCAGCAGG - Intergenic
921829991 1:219717193-219717215 GGAAATGTATATAAAGCAAAAGG + Intronic
923577194 1:235170115-235170137 TGTAATGAATATGAATCAACTGG - Intronic
924126009 1:240852535-240852557 GGTAATTTATATAAAGTACCAGG + Intronic
924879294 1:248141560-248141582 GTTAATGTATAAAAAGACACTGG + Intergenic
1063325177 10:5092851-5092873 AATAAGGTATATAAAGAAACAGG - Intronic
1063714277 10:8512383-8512405 GATTATGTATGTAAAGCATCTGG + Intergenic
1063989154 10:11541364-11541386 GGTAATATACATAAAGCATTTGG - Intronic
1066029491 10:31405453-31405475 TGTACTGAATATAAAGCATCAGG - Intronic
1066472195 10:35710070-35710092 GGTAATTTATAAAAAACAAGAGG + Intergenic
1067460353 10:46453636-46453658 GGCAATGTATATAAAGCATCTGG + Intergenic
1067626837 10:47930967-47930989 GGCAATGTATATAAAGCATCTGG - Intergenic
1067737912 10:48873206-48873228 GGTGATGGACAGAAAGCAACAGG - Intronic
1069344973 10:67458070-67458092 CATAATGTATATAAAGCAGTTGG + Intronic
1069594560 10:69662381-69662403 GGAAATGTACATAAAGTACCTGG - Intergenic
1069859942 10:71464244-71464266 AATAATGTATATAAAGCACCTGG - Intronic
1070010490 10:72469122-72469144 TGTAATGTATATAAAGTGCCTGG + Intronic
1070151727 10:73809367-73809389 GGTAATGTTTCACAAGCAACGGG - Intronic
1071043790 10:81348405-81348427 GGCAATATTTATAAAGAAACAGG - Intergenic
1071197838 10:83182053-83182075 GGCAATGTATTTAAAGCCATTGG - Intergenic
1071356450 10:84801135-84801157 AGTAATTAATATAAAGCATCTGG + Intergenic
1071537093 10:86442731-86442753 GGTAATTTAAATAAAACTACTGG + Intronic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1073147012 10:101287808-101287830 GTTAATATCAATAAAGCAACTGG - Intergenic
1077780292 11:5320630-5320652 GGGAATGAATATAAAACAAGAGG + Intronic
1078659364 11:13274717-13274739 AATAATGTATTTAAAGCATCTGG + Intergenic
1078732257 11:13985638-13985660 GCTAATGCATATAAAGCACCTGG - Intronic
1078924036 11:15858199-15858221 GTTAATGCATGTAAAGCTACCGG - Intergenic
1079648631 11:22898344-22898366 AGTAATGTACGTAAAGCAACTGG - Intergenic
1081260551 11:40954883-40954905 GGAAATGTGTACAAACCAACAGG - Intronic
1082805993 11:57450918-57450940 GATAATGTATATAAAGCTTCTGG + Intergenic
1083231302 11:61322102-61322124 GATAATGTATATAAAGTGCCTGG + Intronic
1084615960 11:70236128-70236150 GGTTACGGATGTAAAGCAACTGG + Intergenic
1085140510 11:74136611-74136633 GATTATGTATATAAAGCACTTGG + Intronic
1086423439 11:86660414-86660436 AGTAATGTATGTAAAGCAGATGG - Intronic
1086881157 11:92155197-92155219 GGTAATACATATAAAGCACTAGG - Intergenic
1088367178 11:109051957-109051979 AATAATCTATAGAAAGCAACTGG + Intergenic
1088575288 11:111265574-111265596 GATAATGTCTACAAAGCACCTGG + Intronic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089793480 11:120961409-120961431 AGTAATATAAATAAAACAACAGG - Intronic
1089943251 11:122441090-122441112 GGTAATGTATATGAAGGTGCGGG + Intergenic
1091566645 12:1653704-1653726 TGTAATGTATGTAAAGCAGCTGG - Intergenic
1091923289 12:4322441-4322463 GGTAAAGTGTATGATGCAACAGG + Intronic
1092844341 12:12570081-12570103 GGAAAGGTATACAAAGAAACTGG + Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1093795879 12:23310002-23310024 GGTAATGTAAATTATGCAGCTGG + Intergenic
1093897397 12:24589934-24589956 GGTAATGTATATCATACATCTGG + Intergenic
1094110494 12:26856701-26856723 GGTAATGTTTGTAAATTAACTGG + Intergenic
1094279734 12:28722419-28722441 GATAATGAATACAAAGCAAGTGG - Intergenic
1094320675 12:29179428-29179450 GGGAATGTATGTAAAGAACCTGG - Intronic
1094749331 12:33387394-33387416 GATAATGTAAATAAAGCATAAGG + Intronic
1095303777 12:40617047-40617069 GATAATGAATATAAAACATCTGG - Intergenic
1095455516 12:42380772-42380794 GATCATGTATATTAGGCAACAGG + Intronic
1095890225 12:47228900-47228922 GGTAATGTTGGTAAAGCACCTGG + Intronic
1097422720 12:59400225-59400247 GGTAATATATAAATAGAAACAGG - Intergenic
1098363578 12:69679272-69679294 GATAACGTATATAAAGCACTTGG + Intronic
1098702499 12:73646307-73646329 GGCAGTGTATAAAAAGCATCAGG - Intergenic
1099945494 12:89239175-89239197 GCTAATATATGTAAAGCAGCAGG + Intergenic
1100166088 12:91919651-91919673 TATTATGTATATAAAGCAACTGG + Intergenic
1100618332 12:96248783-96248805 GGCAATGCATGTAAAGCATCTGG - Intronic
1100688991 12:97018849-97018871 GGAAATGAAAATAAAGCATCAGG + Intergenic
1100734895 12:97516304-97516326 AGTAACGTAAATAAAACAACAGG + Intergenic
1100790139 12:98121112-98121134 GATAATGTATATAAAGCACTTGG + Intergenic
1100949710 12:99832976-99832998 GCTAATGCATATAAAGCATTTGG - Intronic
1101793871 12:107955083-107955105 AGTAATGTAAATAAAGTATCTGG - Intergenic
1107821281 13:44288040-44288062 GATAATGTCTAAAAAGCATCTGG - Intergenic
1107863993 13:44685968-44685990 GGTAATGTGTATATAGAAAAAGG + Intergenic
1110455707 13:75688135-75688157 GGTAATGTATAAAGAAAAACAGG - Intronic
1111975795 13:94966280-94966302 GGTAAGTTATAGAAAGCAATAGG - Intergenic
1113268586 13:108646920-108646942 GGAAATGTCCATCAAGCAACTGG - Intronic
1115362031 14:32514716-32514738 TGTAATGAAGAAAAAGCAACAGG + Intronic
1116055623 14:39860938-39860960 GGTCATGTATGTAAAGCTCCTGG + Intergenic
1116248880 14:42456005-42456027 GGGAATGTATATTAAGCATATGG + Intergenic
1118070714 14:62244319-62244341 GCTAATGTATATAAGGCTTCTGG - Intergenic
1118466793 14:66038486-66038508 GGTAATGGATTTAAAGAAGCTGG - Intergenic
1119842462 14:77803531-77803553 GGTTATGAAAATGAAGCAACAGG - Intronic
1120000887 14:79302176-79302198 TGTAATATATGTAAAGCACCTGG - Intronic
1121939657 14:98057844-98057866 GAAACTGTATATAAAGTAACTGG + Intergenic
1123504058 15:20920663-20920685 GGTACTGTTTACAAATCAACAGG - Intergenic
1124402455 15:29361375-29361397 GCCAATGTATAAAAAGCACCAGG + Intronic
1125263450 15:37852979-37853001 TGGAATATATTTAAAGCAACTGG + Intergenic
1128364605 15:66988858-66988880 GGTAATCTATATAATGCTTCTGG + Intergenic
1130742679 15:86618182-86618204 GATAATTTAAATAAAGAAACAGG + Intronic
1131106005 15:89735257-89735279 GGTAATGAAAATAAAAGAACTGG - Intronic
1131788911 15:95942951-95942973 GATCATGTACATAAAGCTACTGG + Intergenic
1133542523 16:6770320-6770342 AATAATGTATTTAATGCAACAGG + Intronic
1133907112 16:10032534-10032556 GTTAATTTATATAAAGCACTTGG - Intronic
1133973357 16:10582242-10582264 GGTTATGTTTGTAAAGTAACCGG - Intergenic
1134385844 16:13771654-13771676 GGTAAGGTTTATAAAGCACTTGG - Intergenic
1135936806 16:26787522-26787544 ACTAATGCATATAAAGTAACTGG + Intergenic
1137888445 16:52132020-52132042 GGTAATGTATAAAGAGAAAGAGG + Intergenic
1138196134 16:55053602-55053624 GTTAATGCATATGAAGCAATTGG + Intergenic
1140185897 16:72771555-72771577 GGTAAGATATATAAAGCACATGG - Intergenic
1140520834 16:75580070-75580092 GATAATGTATGTAAATCATCTGG - Intergenic
1140789814 16:78380685-78380707 GGCAATGTATCTAAAGCAGTTGG - Intronic
1140925302 16:79576765-79576787 GATAATGTATGTAAAGCACCTGG - Intergenic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1142910003 17:3080895-3080917 GATAATGTATATAAAAAAAGAGG + Intergenic
1144317994 17:14082181-14082203 GGTAAGGTATATAATGGACCCGG + Intronic
1146483076 17:33220632-33220654 GTTAATGTATACAAAGCACCCGG + Intronic
1147292330 17:39453809-39453831 GGTTATGCAAATAAAGCAAATGG + Intergenic
1148357052 17:46982464-46982486 GGTAATGTATTTAATGCACTGGG - Intronic
1149688577 17:58554066-58554088 ATTAATGTATATAAGGTAACCGG + Intergenic
1151015875 17:70552155-70552177 GAGAATGTTCATAAAGCAACAGG + Intergenic
1153827927 18:8893906-8893928 TGTAATGGAGATAAAGCTACTGG + Intergenic
1154380330 18:13843836-13843858 GGTAATGCATTTAAAGCACTTGG + Intergenic
1156877668 18:42035223-42035245 GGTAATATACATATAACAACTGG + Intronic
1157007983 18:43609424-43609446 GTTAATGGGTATAAAGTAACTGG + Intergenic
1157465772 18:47943619-47943641 GGTAATGGATATAGAGAAATAGG + Intergenic
1166652926 19:44588565-44588587 GGGCATGAATATAAAGAAACAGG - Intergenic
1167127933 19:47563951-47563973 GTTAATGCATATAAAGCACTTGG - Intergenic
1168183851 19:54684263-54684285 GGTATTGACTAAAAAGCAACAGG - Intronic
925013544 2:504266-504288 TGTAATATATATAAAAGAACAGG - Intergenic
925683310 2:6445712-6445734 AGTAATGCATATAAAGCACCTGG - Intergenic
926497716 2:13612203-13612225 GGTAAGTCATATGAAGCAACAGG + Intergenic
926932733 2:18056564-18056586 GATAATGCATGTAAAGCACCTGG + Intronic
927020502 2:19011864-19011886 TATAATGTCTATAAAGCATCTGG + Intergenic
928048517 2:27964317-27964339 GGGAATTTATATAAAGAAAAAGG - Intronic
928422533 2:31149933-31149955 GATAATGTATACAAAGCACCTGG + Intronic
928493859 2:31812035-31812057 GTTAATGGATATAAAGCATTTGG + Intergenic
928694659 2:33837052-33837074 GATAATGTATATAAAACACTTGG - Intergenic
929659034 2:43764705-43764727 GATAATGTGTATAAAGTACCAGG - Intronic
931800661 2:65755198-65755220 GGTAATTTATATAAAAAAAGAGG + Intergenic
933304706 2:80582755-80582777 GATAATGAATAGAAAGCAAGAGG + Intronic
933796849 2:85926853-85926875 GGTAATGCATGTAATGCACCTGG + Intergenic
935646939 2:105345167-105345189 GGGAATATATTTAAAGAAACAGG - Intronic
936770893 2:115911998-115912020 GTTAATGTATAAGAAGCCACTGG + Intergenic
937005313 2:118506850-118506872 GATAGTGTATGTAAAGCACCTGG + Intergenic
937486772 2:122323555-122323577 GATAAAGTATTTAAAGCATCTGG + Intergenic
938981284 2:136529659-136529681 GGTAATGTATGTAAATCCTCTGG + Intergenic
939375857 2:141366051-141366073 GTTGATGAATATAAAACAACTGG + Intronic
939583781 2:143982964-143982986 AGAGATGTATATAAACCAACAGG + Intronic
939950108 2:148460747-148460769 GGAAATGTTTTTAAAGCATCTGG + Intronic
940700543 2:157036343-157036365 AGTAATATACATAAAGCTACTGG + Intergenic
940807599 2:158205502-158205524 AATGATGTATATAAAGCACCCGG - Intronic
940823334 2:158382447-158382469 GGAAATGTGTATAAGGCAAAGGG + Intronic
941355189 2:164482460-164482482 GGCAATGTATATTAAACAAGAGG - Intergenic
941445734 2:165596895-165596917 GATAATGTCTATAAAGCTATTGG - Intronic
942451664 2:176112150-176112172 GGGAATGTATTTGAAGCAAACGG + Intronic
942589508 2:177526941-177526963 GGTTCTGAATATAAAGTAACTGG + Intronic
942938890 2:181593053-181593075 TGTAATGTATGCAAAGCAGCAGG - Intronic
948217408 2:236242074-236242096 GGTAATACTTAAAAAGCAACTGG - Intronic
1168982609 20:2020742-2020764 GATAATGCATATAAAGCATTTGG - Intergenic
1169243479 20:4005230-4005252 GGCAATATATTTAAAGCTACTGG + Intronic
1170130638 20:13015347-13015369 GGTAATGCATAAAAAGCAATTGG + Intronic
1171115878 20:22524387-22524409 GATAATCTATGTAAAGCACCTGG + Intergenic
1172330381 20:34071853-34071875 GGGAATGTATGTAAAGCACCTGG + Intronic
1172874552 20:38156297-38156319 GGGAATGCATAAAAAGCCACAGG + Intronic
1174214787 20:48908068-48908090 GTTAATGTATATGCAGCACCTGG - Intergenic
1174777550 20:53359125-53359147 AATAATGTCTATAAAACAACTGG - Intronic
1174791740 20:53484728-53484750 AGTAATGTGTATAAAGTGACTGG + Intronic
1177280572 21:18977065-18977087 GCTTATGTAAATAAAGAAACAGG - Intergenic
1178164456 21:29957452-29957474 GATAATGCATATAAAGTAACTGG - Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1178677056 21:34639948-34639970 GGGAATGTATTTAATGCCACCGG - Intergenic
1181876233 22:25943091-25943113 GTCATTGTAAATAAAGCAACAGG - Intronic
1182169103 22:28208635-28208657 AGTAATTTATATAGAGCAAAAGG - Intronic
1184801167 22:46761035-46761057 GGTAAGCTATAAAAAGCACCCGG + Intergenic
949657362 3:6235935-6235957 GGTAATTTATATAAAAAAAGAGG - Intergenic
949955064 3:9260510-9260532 TATAATGTAAATAAAGCCACTGG + Intronic
950201274 3:11046067-11046089 GGAATAGTATACAAAGCAACTGG + Intergenic
950316025 3:12003125-12003147 GATCATGTATGTAAAGCATCTGG - Intergenic
951547054 3:23837138-23837160 AGAAATGTATATAAAGCACTTGG + Intronic
951870040 3:27351520-27351542 GGTAATGCAGGTAAAGCAGCGGG + Intronic
952179007 3:30898094-30898116 GGGAATGTATAAAAAGCATTTGG - Intergenic
952398643 3:32943212-32943234 GTTAGTGTATAAAATGCAACTGG + Intergenic
953200983 3:40778379-40778401 GGTAATGTCTATAAAGCACCTGG + Intergenic
953603355 3:44389382-44389404 TTTAATGTATAAAAATCAACTGG - Intronic
954044591 3:47918651-47918673 GGTAATCAATATAAATCATCAGG - Intronic
954684538 3:52363234-52363256 GGTAATGCCTGTAAAGCACCGGG - Intronic
955139709 3:56257099-56257121 GATAATGTATGTAAAACCACTGG + Intronic
955696266 3:61640481-61640503 GGTAATGTGCAAAAAGCACCTGG - Intronic
955896844 3:63709451-63709473 GACAATGTATATAAAGCATTTGG - Intergenic
956875267 3:73456952-73456974 GGTAATGTCTATTAAGTACCAGG - Intronic
958906733 3:99950121-99950143 GGTAAAGTTTATAAAGCACAAGG + Intronic
959088991 3:101882144-101882166 GGTAATAAATATAAATCAATGGG - Intergenic
959946791 3:112133751-112133773 GGCAAGGTATGCAAAGCAACTGG + Intergenic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
962698051 3:137970441-137970463 GGTAATATATACAAGGCACCTGG - Intergenic
962705077 3:138035406-138035428 GTTAAAGTATATAAAGCACTAGG - Intergenic
964127936 3:153255975-153255997 GTTAATATTTATAAAGCATCTGG - Intergenic
964198067 3:154087637-154087659 GACAATATATATAAAGCACCTGG + Intergenic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
964449483 3:156797725-156797747 GATAATGTATATAAAACATCTGG - Intergenic
965051198 3:163649932-163649954 GTCTATGTATATAAAGCAAATGG + Intergenic
965461398 3:168969052-168969074 GGTACTGTATATAAAGTATTTGG - Intergenic
965642960 3:170850390-170850412 GATAATATATTTAAAGCACCTGG + Intronic
965663623 3:171068234-171068256 GGTAATGGATCTAAAGCAGTTGG - Intronic
965663701 3:171069254-171069276 GGTAATGTATATTAAAAACCTGG + Intronic
965946139 3:174243578-174243600 AGAAATGTATAAAAAGAAACTGG - Intronic
966270354 3:178097282-178097304 GATAATGTATGTAAAGCACCTGG + Intergenic
966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG + Intergenic
967217631 3:187223975-187223997 GTTAATGAACATAAAGCACCTGG + Intronic
967428528 3:189355179-189355201 GGTAATTTTTATGAAGCAAGGGG + Intergenic
968248975 3:197187671-197187693 TGAAATGTACATGAAGCAACAGG - Intronic
969841184 4:9883521-9883543 GGTGATGTATATAAGGCAGCTGG + Intronic
969842968 4:9896983-9897005 ATTAATATATATAAAGCAGCCGG - Intronic
972377990 4:38491040-38491062 GATAATGTATATAAAGTACTTGG - Intergenic
972975189 4:44625560-44625582 GGTGATTTATATAAACTAACTGG + Intronic
973258067 4:48133093-48133115 GATAATGAATATAAAGGAACTGG + Intronic
973609996 4:52626916-52626938 GGTAATTTATTCAGAGCAACTGG + Intronic
975337700 4:73199415-73199437 GGTACTCTATATAAAGTAATGGG - Intronic
976494976 4:85717703-85717725 GGAAAAGTATATAAAGGAAATGG - Intronic
977487595 4:97668189-97668211 GGTAAGGTATTCAAGGCAACAGG + Intronic
978084765 4:104637354-104637376 GGAAATGTACAGAAAGCAATTGG - Intergenic
978627703 4:110705895-110705917 GATAATGCACATAAAGCACCTGG + Intergenic
978925528 4:114238143-114238165 GGTGATGTGAATAAAGCAAAGGG + Intergenic
979466344 4:121042950-121042972 GATTATGCATATAAAGCAGCAGG + Intronic
979482246 4:121233465-121233487 GATAATGTTTGTAAAGCATCTGG - Intergenic
979577216 4:122307840-122307862 TGTAATTTTTATTAAGCAACAGG + Intronic
980847323 4:138339605-138339627 AGAAATGTATAGAAAGCAAGCGG + Intergenic
981345240 4:143668134-143668156 AGTAATGTAAATAAAGTCACAGG + Intronic
981502130 4:145463212-145463234 GGGAATGTGTATAAAGCATAAGG - Intergenic
982413253 4:155103373-155103395 GGTAATGTATACAAAGACATAGG - Intergenic
982728842 4:158934003-158934025 GATAATACATATAAACCAACTGG - Intronic
983809496 4:172042026-172042048 GGTCATGTGTAGAAAGCAAGGGG + Intronic
984632198 4:182073062-182073084 GGTAATTTATATAAAGAAAAGGG + Intergenic
984655372 4:182311660-182311682 GGTCATATATGTAAAGCACCTGG + Intronic
986110087 5:4707086-4707108 GGTAATGTATAAAGAGCAGAGGG - Intergenic
990966325 5:61452169-61452191 GTTACAGTATATAAAGGAACAGG - Intronic
991251671 5:64569016-64569038 GGACCTATATATAAAGCAACAGG - Intronic
991252943 5:64583942-64583964 GATAATGTGTATAATGCACCTGG - Intronic
992926040 5:81588275-81588297 GATAATGTATATAAAGTGTCTGG - Intronic
995070138 5:107911496-107911518 GTTAATATATATAAAGTACCTGG - Intronic
995530950 5:113091460-113091482 GGAAATGAAAATAAAGCAACTGG + Intronic
996977367 5:129451154-129451176 GGTAATGTATACACAGAGACAGG + Intergenic
997143009 5:131402961-131402983 TGTAAGGTATAAAAATCAACAGG + Intergenic
997667626 5:135644546-135644568 GATAATGAATATAAAGCCTCTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999005261 5:147969256-147969278 GGTAATGTATATAAAGTGTTTGG + Intergenic
999316152 5:150585393-150585415 GAGAATGTATATAAAGGACCTGG - Intergenic
1000493437 5:161945973-161945995 GGAAATCTAAATAAAGCAAGTGG + Intergenic
1000754023 5:165134011-165134033 GGTAGTGAATGTAAAGCATCTGG - Intergenic
1000921664 5:167145396-167145418 GATAATGTATGAAAAGCAACAGG + Intergenic
1001111322 5:168898700-168898722 GAGAATGTATATAAAGTAATGGG + Intronic
1001432323 5:171672685-171672707 GATAATGTCTATAAAGCGCCTGG + Intergenic
1002137767 5:177118609-177118631 GGGAATGTTTATAACACAACAGG + Intergenic
1003349769 6:5305214-5305236 TGTAATGTTTATAATCCAACTGG - Intronic
1004021568 6:11780467-11780489 GCTAATATGTGTAAAGCAACTGG - Intronic
1004182812 6:13395641-13395663 GATAACTTATGTAAAGCAACTGG + Intronic
1005026536 6:21467621-21467643 CATAATATATATAATGCAACTGG + Intergenic
1005058181 6:21750314-21750336 GGTTATGTCTATCAAACAACTGG - Intergenic
1008092316 6:47306561-47306583 GATACTGTATACAAAGCACCTGG + Intronic
1008307753 6:49925633-49925655 GGAAATGTATATCAGGCAAGAGG - Intergenic
1010986489 6:82431148-82431170 GGTTATACATATAAAGCACCTGG + Intergenic
1011806184 6:91075108-91075130 GGAAAGGGATATAAAGGAACTGG + Intergenic
1012596101 6:101042424-101042446 GTTAATGTAAATGAAGCAATAGG + Intergenic
1015399555 6:132773534-132773556 GGTAACATATATTAAGTAACTGG - Intronic
1016218145 6:141628600-141628622 CTTCATGTAGATAAAGCAACTGG + Intergenic
1016624271 6:146147210-146147232 GATAATGTATAGAAAACTACTGG + Intronic
1017563761 6:155662376-155662398 GATAATGTATATAAGGCATCTGG - Intergenic
1017564109 6:155665924-155665946 AATAATGTCTATAAAGCACCAGG - Intergenic
1017618517 6:156270799-156270821 GGTATTGAAGCTAAAGCAACTGG + Intergenic
1019889199 7:3932437-3932459 GGTTATCTATTTAAACCAACTGG - Intronic
1019993462 7:4708275-4708297 GGTCATGTTTACAAAGCATCGGG - Intronic
1020678192 7:11204693-11204715 GATAATGTATGTAAAACAAGTGG + Intergenic
1021416791 7:20395685-20395707 GGTCATGTATGTAAAGTGACTGG - Intronic
1021582710 7:22174091-22174113 GACAGTGTATCTAAAGCAACTGG + Intronic
1022125614 7:27353396-27353418 GATAGTGTATATAAAGTACCTGG - Intergenic
1022335353 7:29416684-29416706 AGTTAAGTATATAAGGCAACTGG + Intronic
1024398766 7:48899298-48899320 GGTCCTGTATATAAAGAAACTGG - Intergenic
1024452320 7:49561652-49561674 GGAAAAGGGTATAAAGCAACAGG + Intergenic
1025886513 7:65599366-65599388 GATATTGTATATAATGCTACTGG + Intergenic
1028041619 7:86060870-86060892 GGTAATTTATAAAAAGAAAGAGG + Intergenic
1028122244 7:87069360-87069382 GTTAATGTACCTAAAGCATCTGG + Intergenic
1028990616 7:97045312-97045334 GGTTATGAAAATAAAGAAACAGG + Intergenic
1032432306 7:131871984-131872006 GGTAAGTTATATAAAGCACTTGG - Intergenic
1032571316 7:133002228-133002250 GATAACATATATAAAGCACCTGG - Intronic
1032578332 7:133079541-133079563 GGTAAGGTATGTAAAGCACCTGG - Intronic
1032666059 7:134037608-134037630 GTTCATGTTTATAAAGCCACGGG - Intronic
1033429215 7:141273779-141273801 GGTACTGTAGATAAAGAAACGGG - Intronic
1033651432 7:143346534-143346556 GGAAATGGACACAAAGCAACAGG - Intronic
1033779783 7:144654765-144654787 GTTAATATATATAAAGCACTTGG + Intronic
1036046609 8:5148788-5148810 GGTAAAGTATATATATCAACTGG - Intergenic
1036952671 8:13156407-13156429 GCTAATATATAAAAAGCATCTGG - Intronic
1036962539 8:13260981-13261003 GGACATGTATATAAACCAAAAGG - Intronic
1036993068 8:13621344-13621366 GGTAATGTTTATAAGGCTAAAGG + Intergenic
1038222360 8:25622708-25622730 GCTAATGTGTATAGAGTAACTGG - Intergenic
1038269693 8:26065160-26065182 GGTTCTCTATTTAAAGCAACAGG + Intergenic
1038587841 8:28806883-28806905 ATAAATGTATTTAAAGCAACCGG - Intronic
1039553031 8:38457002-38457024 GGTGATGTATAAAATGCAGCTGG - Intronic
1039622577 8:39012086-39012108 GGTAAAGGATATAATGCATCAGG + Intronic
1039739852 8:40372670-40372692 GGTAATTTATATAGAGGAAAAGG - Intergenic
1041120354 8:54580176-54580198 GTCAATGTATATAAAGCACTTGG + Intergenic
1041597465 8:59672828-59672850 GATAATGTATATAAAGTACCTGG + Intergenic
1041620694 8:59964526-59964548 GGTACTGTATATAAATCATCTGG - Intergenic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1043827319 8:84945090-84945112 TGTAATTTAAATAGAGCAACTGG + Intergenic
1044331736 8:90928361-90928383 AGTCATGGATATAAAGCAATGGG - Intronic
1045348096 8:101312878-101312900 AGTAAAGTATATAAAGCACTTGG + Intergenic
1045717450 8:105065373-105065395 GGAAATGAATATAAAGAAAGAGG + Intronic
1046076107 8:109313527-109313549 AGTAATGTATTTGAAGCAAAAGG - Intronic
1046547665 8:115671708-115671730 TGTAATGTATCTAAAGCATGAGG - Intronic
1047976500 8:130135685-130135707 ACTAATGTATATAAGGCACCTGG + Intronic
1049041743 8:140117347-140117369 GGTAATTTATAAGGAGCAACTGG + Intronic
1051134025 9:13897599-13897621 TCTAAAGTATATAAGGCAACTGG + Intergenic
1051322886 9:15928547-15928569 GGTAAGGAAAATAAAGCAAAAGG - Intronic
1051422072 9:16898560-16898582 GTCAATGTATGTAAGGCAACAGG - Intergenic
1051865672 9:21678300-21678322 GGTAATATAAGTAAAACAACTGG + Intergenic
1052993700 9:34538009-34538031 TTTAATGTATATAAAGAAACTGG - Intergenic
1053352669 9:37423814-37423836 GTTTATGTATATGAAGCACCTGG - Intronic
1054831449 9:69629916-69629938 GCTAATGTATTTCAAGCACCTGG - Intronic
1054937080 9:70699555-70699577 GGTAATGTATATAAAGTGCCTGG - Intronic
1055189597 9:73501236-73501258 TGTAATATATAAAATGCAACTGG + Intergenic
1055437115 9:76302886-76302908 GCTAAACTATATAAAGCAAGGGG - Intronic
1056325818 9:85478160-85478182 GATAGTGTATATAAAGCACTTGG - Intergenic
1057502528 9:95607083-95607105 GATAATATATATAAAGCACGTGG - Intergenic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1058281575 9:103122661-103122683 GGTAATTTATATAATGCTTCAGG + Intergenic
1058936076 9:109770863-109770885 GATAATGTATACAAAGCTCCTGG - Intronic
1059559077 9:115314348-115314370 GGTAATGTATAAAAAAATACTGG + Intronic
1059813598 9:117885354-117885376 GATAATGTTTGTAAAGCACCTGG + Intergenic
1059918411 9:119129945-119129967 GGTAAGGTACATAAAGTAAAAGG - Intergenic
1060229486 9:121816041-121816063 CGTAATGTATGTAAAGAACCGGG - Intergenic
1060768075 9:126309805-126309827 TGTAATGTATATAGAGCAGGAGG + Intergenic
1060799749 9:126536164-126536186 GCCAATGCTTATAAAGCAACTGG - Intergenic
1061596709 9:131635203-131635225 GATAAAGTATATAAAGTACCTGG - Intronic
1185559238 X:1046059-1046081 GGTAATGCAAATAAAAGAACAGG - Intergenic
1186704468 X:12127260-12127282 GGTAATTTATATTAAAAAACAGG + Intergenic
1187019845 X:15369511-15369533 TGTAATGGATATGGAGCAACAGG + Intronic
1187102308 X:16206519-16206541 GATAATGTAGATAAAACACCTGG + Intergenic
1187797703 X:23022519-23022541 AGTAATGAAAATAAAGCAACTGG - Intergenic
1188440671 X:30212960-30212982 GTTAATGTATGTAAAGCACCTGG - Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1188445911 X:30253125-30253147 TGTAATGTATGTAAGGCATCTGG - Intergenic
1189376218 X:40468189-40468211 GGTAATGCATATAAACCACTTGG - Intergenic
1192068350 X:67910760-67910782 GTTAATGTATATCAGGCAAATGG + Intergenic
1192351711 X:70361429-70361451 GGTGATGTATATAATGATACAGG - Intronic
1193811732 X:86059460-86059482 GGTAATGTAAATGAAGGAAGTGG - Intergenic
1193942598 X:87694643-87694665 GGTAATTTATAAAAATCAAGAGG + Intergenic
1193950114 X:87787328-87787350 GGTAATTTATATAAAAAAAGAGG + Intergenic
1194038424 X:88910001-88910023 GGTAATATATGTAAAGTAAATGG + Intergenic
1194258521 X:91665571-91665593 GGAAATGTATATAAAGTCTCAGG + Intergenic
1195155739 X:102122543-102122565 GGTAATTTATGTAAAGTCACTGG - Intergenic
1195843474 X:109200687-109200709 GATAATGTATATAAAGTTCCAGG + Intergenic
1196728206 X:118915986-118916008 GATGATGTATCTAAAGCATCTGG + Intergenic
1197092292 X:122553717-122553739 GGTCATTTTTATAAAGCAAAGGG + Intergenic
1200577287 Y:4905070-4905092 GGAAATGTATATAAAGTCTCAGG + Intergenic
1201787679 Y:17803597-17803619 TATAATGCAAATAAAGCAACTGG + Intergenic
1201813874 Y:18102391-18102413 TATAATGCAAATAAAGCAACTGG - Intergenic
1201928456 Y:19315563-19315585 GGTGATTTATATAAAGAAAGAGG + Intergenic
1202351503 Y:23997141-23997163 AGTAGTGTAAATAAAGCCACAGG + Intergenic
1202519276 Y:25672978-25673000 AGTAGTGTAAATAAAGCCACAGG - Intergenic