ID: 903257339

View in Genome Browser
Species Human (GRCh38)
Location 1:22111705-22111727
Sequence GCTTCAACTGGGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903257339_903257348 26 Left 903257339 1:22111705-22111727 CCTCCCTCTTTCCCAGTTGAAGC No data
Right 903257348 1:22111754-22111776 GATCCTCTTGGTCACTTCTCTGG No data
903257339_903257344 4 Left 903257339 1:22111705-22111727 CCTCCCTCTTTCCCAGTTGAAGC No data
Right 903257344 1:22111732-22111754 TGAATTCATAGCAGCAGCCCTGG No data
903257339_903257345 14 Left 903257339 1:22111705-22111727 CCTCCCTCTTTCCCAGTTGAAGC No data
Right 903257345 1:22111742-22111764 GCAGCAGCCCTGGATCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903257339 Original CRISPR GCTTCAACTGGGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr