ID: 903259293

View in Genome Browser
Species Human (GRCh38)
Location 1:22122658-22122680
Sequence CTGTGTCCGCAGGAGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903259287_903259293 0 Left 903259287 1:22122635-22122657 CCTTCTGTCTCTTGCCTGAGTGT 0: 1
1: 2
2: 1
3: 49
4: 320
Right 903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 149
903259286_903259293 20 Left 903259286 1:22122615-22122637 CCTCTGTACGCTGTGACTGTCCT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903259293 Original CRISPR CTGTGTCCGCAGGAGCGGAG GGG Intronic
900502984 1:3015744-3015766 CTGTGTCCTCAGTGGCAGAGAGG - Intergenic
900932454 1:5745922-5745944 CTGTGGCCGGAGGAGCGGCAGGG - Intergenic
900948654 1:5845233-5845255 GTGTGCCTGCAGGAGCGGGGAGG + Intergenic
901215288 1:7551572-7551594 CAGTGTCCCCAGTAGGGGAGGGG - Intronic
901279801 1:8025771-8025793 CCGGGACCGCAGGAGCGGACGGG - Intronic
901393322 1:8962671-8962693 CTGTGGCTGCAGGAGGGAAGGGG + Intronic
902708160 1:18220830-18220852 CTGTGTGTGCAGGAGAGCAGAGG + Intronic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
905107422 1:35572860-35572882 CTGTGTGCGCATGAGCAGATAGG + Intergenic
907774650 1:57501990-57502012 CTGTCTCCGCAGTACCGGAGAGG + Intronic
913161756 1:116151857-116151879 CTGTGACAGCAGGAGAGGATGGG - Intergenic
914239894 1:145846337-145846359 CTGTGTCCACTGGAGGGGAGAGG + Intronic
914676657 1:149911482-149911504 CTGGGTCCACAGGAGCCCAGGGG + Intronic
915277152 1:154797077-154797099 CAGTCTCCGAAGGAGAGGAGAGG + Intronic
915310585 1:155004087-155004109 CTGGGTCCGGAGCAGGGGAGGGG + Intronic
921389247 1:214603119-214603141 CTGAGTGCGCAGGCGCGGATTGG + Intergenic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
923492827 1:234499409-234499431 ATGTGTCCCCAGGAGGGGAAGGG - Intergenic
923672963 1:236056735-236056757 CTGTGTCCCTGGGAGGGGAGTGG - Intronic
1069579916 10:69558986-69559008 CTGGGCCCACAGGAGGGGAGGGG - Intergenic
1069594743 10:69663284-69663306 CTGTGTCAGCAGGAGCCCACAGG - Intergenic
1069703310 10:70441572-70441594 CCGCGTACGCAGGAGCGCAGTGG + Exonic
1070674326 10:78401905-78401927 CTGTGTCCCCAGGACCGGGATGG + Intergenic
1070957590 10:80474441-80474463 CTGTGCCCTCAGGACGGGAGGGG + Intronic
1071560624 10:86644591-86644613 CTGTGTCCCCAGCAGGGGACAGG - Intergenic
1075105712 10:119538778-119538800 GGGTGGCAGCAGGAGCGGAGGGG - Intronic
1075573769 10:123563623-123563645 CTGTGGTCGCTGGAGAGGAGAGG + Intergenic
1075659629 10:124184406-124184428 CAGTGTCAGCTGGAGAGGAGCGG + Intergenic
1076626681 10:131825120-131825142 CCCTGTCCTCAGGAGCAGAGGGG + Intergenic
1078320161 11:10327276-10327298 CTGAGTCTTCAGGAGTGGAGTGG - Intronic
1079312360 11:19378163-19378185 CTGTGACAGCAGAAGCGGATGGG - Intronic
1080853367 11:36090760-36090782 CTGTGTCTGTAGGAGAGGAAAGG - Intronic
1083596440 11:63920119-63920141 CTGTGTCCCCATGAGGGCAGGGG + Intergenic
1084455526 11:69266059-69266081 CTGTGTGGGCAGGACCTGAGGGG - Intergenic
1086103928 11:83129175-83129197 CTGTGTCCACAGGGGCTGACAGG - Intergenic
1089579879 11:119474964-119474986 CTGTGACCCCAGGAGAGGTGGGG - Intergenic
1090621552 11:128565251-128565273 CTGTGTCCTCAGTGGCGGAAGGG - Intronic
1090991407 11:131820184-131820206 CAGTGGCTGCAGGAGAGGAGGGG - Intronic
1091912355 12:4242742-4242764 CTGTGCCTGCAGGAGCAGACTGG + Intergenic
1096317557 12:50581724-50581746 CTGAGTCAGCAGGAGTTGAGTGG - Intronic
1097155651 12:57010372-57010394 CTGTGGCAGCAGGAGAGAAGGGG + Intronic
1098377955 12:69837456-69837478 CTGTCTCCGGGGGAGTGGAGAGG + Intronic
1102195949 12:111025270-111025292 CTGTGGCCGCAAGAGGGGATTGG + Intergenic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1104030815 12:125065008-125065030 CTCTGTCAACAGGAGAGGAGGGG - Intergenic
1108089815 13:46837249-46837271 CTATTTCCCCAGGAGCAGAGAGG - Intronic
1108597277 13:51960383-51960405 CTGTGTCCTCAGAAGGGGAGTGG - Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115022183 14:28695674-28695696 CGGTGTCCTCAGGAGAGCAGTGG - Intergenic
1121507364 14:94487047-94487069 CTCTGCCCGCTGGAGGGGAGAGG + Intergenic
1122138454 14:99647862-99647884 CTGTGTCCTCTGGAGGAGAGAGG + Intronic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1127820049 15:62646833-62646855 CTCTGTCCCCAGGTGCTGAGAGG + Intronic
1129299173 15:74615688-74615710 CGGCGCCCGCCGGAGCGGAGAGG + Exonic
1129608389 15:77035756-77035778 CAGTGTCCCCAGAAGGGGAGGGG + Intronic
1129749206 15:78048810-78048832 CTGAGACAGCAGGAGAGGAGAGG - Intronic
1130368749 15:83264578-83264600 CTTTGTCCACAGGAGTGGGGAGG + Exonic
1132831327 16:1929811-1929833 CTGCGTGCGCAGGCGCGGCGGGG - Intergenic
1137728094 16:50670463-50670485 CTGGGTCCACAGGAGAGGTGAGG - Intronic
1139392628 16:66614538-66614560 CTGGGTGTGCAGGAGTGGAGAGG + Intergenic
1139953200 16:70681698-70681720 CTGTTTCCCCAGGAGGGGAGGGG - Intronic
1140216884 16:73015803-73015825 CTGTCTCCGCAGCACCTGAGAGG + Intronic
1141157816 16:81609529-81609551 CTGTCTCCCCAGGGGCTGAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141533959 16:84666037-84666059 CTGAGTGCCCAGGAGGGGAGGGG + Intronic
1142291221 16:89194433-89194455 GTGTGTCCCCACGAGCTGAGAGG + Intronic
1142720095 17:1770190-1770212 CTGTGTAAGCAGGAGCTCAGGGG + Intronic
1142978942 17:3660497-3660519 CTCTGGCCCCAGGAGCAGAGTGG - Intronic
1145000290 17:19300138-19300160 CAATGTCCGGAGAAGCGGAGGGG + Intronic
1146286083 17:31575033-31575055 CTGTGTTCACAGGAGGGGCGTGG - Intronic
1146936205 17:36814077-36814099 CTGTTCCCTGAGGAGCGGAGTGG + Intergenic
1147318292 17:39631547-39631569 CAACCTCCGCAGGAGCGGAGGGG - Intronic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1148479739 17:47952355-47952377 CTTTGCCCTCAGGTGCGGAGGGG - Exonic
1150484684 17:65535711-65535733 CTGTGTCCTCAGGTGCTGTGTGG - Exonic
1151699832 17:75737261-75737283 CTGGGTCCTCTGGGGCGGAGGGG + Intronic
1152389248 17:79992956-79992978 TTGTGTCCCCAGGAGGGGAGTGG - Intronic
1155895766 18:31324021-31324043 CTCTGTCCCCAGGAGTGCAGTGG + Intronic
1157610283 18:48951436-48951458 CTGGGCCCCCAGGAGCGCAGGGG - Intergenic
1158311731 18:56166627-56166649 CCGAGTCCCCAGGAACGGAGAGG - Intergenic
1158598127 18:58834229-58834251 CTGTGTCCTCAGGGCCGAAGAGG - Intergenic
1160697109 19:489966-489988 CGGCGTCCCCAGAAGCGGAGCGG + Intronic
1162060178 19:8090098-8090120 CTGTGTCCCCAGGAGGGCAGCGG - Exonic
1162111917 19:8404031-8404053 CTGTGTGCGGAGGAGCGGGTGGG - Exonic
1164616132 19:29667713-29667735 CTGTGTCCGGAGTAGGAGAGAGG + Intronic
1164740344 19:30571248-30571270 CTGTGTCCCCAGTAGAGGTGAGG + Intronic
1166732168 19:45065051-45065073 CTGTGTGGCCAGGAGCGGATGGG + Intronic
1168241496 19:55091304-55091326 CAGAGTCCCCAGGAGCCGAGGGG - Exonic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
926045214 2:9704906-9704928 CTATGTCTTCTGGAGCGGAGGGG - Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927720544 2:25379205-25379227 CTGTGACTGCAGGAAGGGAGGGG + Intronic
927902270 2:26829096-26829118 CTGTCTCCACAGGAGCAGCGGGG + Intergenic
935756297 2:106278593-106278615 CTGTGTTCTCTGGAGCAGAGAGG - Intergenic
937868071 2:126768768-126768790 CTGTGTCTCCAGGAGAGGTGGGG + Intergenic
938767202 2:134468292-134468314 CTGTGTCCTCACATGCGGAGGGG - Intronic
941744184 2:169068882-169068904 CTGAGGCCGCAGGCGAGGAGGGG - Intronic
948163649 2:235844712-235844734 CTGTGTGCCCAGGTTCGGAGAGG - Intronic
1169052928 20:2595772-2595794 CTGTGTCTCCAGGAGAGGAGTGG + Intronic
1175303150 20:57957165-57957187 CTGTGTCCCCAGGAAGGGTGAGG + Intergenic
1175342902 20:58246099-58246121 GTGTGTCGGCTGGAGCTGAGTGG - Intergenic
1176037356 20:63046197-63046219 CCGTGTCCTCTGGAGGGGAGCGG - Intergenic
1176149974 20:63585785-63585807 CTGTGTCCTCAGCTGAGGAGTGG + Intergenic
1176408186 21:6433291-6433313 CTGTTTCTCCAGGATCGGAGGGG + Intergenic
1178499760 21:33116012-33116034 CTCTGTCTGCAGGACCCGAGCGG - Intergenic
1178944320 21:36933615-36933637 CTTTGTCCACCGGAGAGGAGAGG - Intronic
1179654076 21:42834336-42834358 CTGTGTTTGCAGGGGCGGGGAGG + Intergenic
1179683677 21:43041617-43041639 CTGTTTCTCCAGGATCGGAGGGG + Intergenic
1181015298 22:20065218-20065240 CTGTGGCCACAGGAGAGGAGGGG - Exonic
951078682 3:18425749-18425771 CAGCGTCCGCCGGAGCGGGGAGG + Intronic
952605663 3:35144627-35144649 CTATGCCTGCAGGAGTGGAGGGG - Intergenic
952892025 3:38049668-38049690 CTGTGTCTGCAGGAGCTGTCAGG - Intronic
954082384 3:48220173-48220195 CTGGGTCTGCAGGAGAGGAAGGG + Intergenic
956696663 3:71924300-71924322 CTGTGTCTTCAGGAGTGGGGGGG + Intergenic
966787658 3:183635802-183635824 CTGAGTCCTCGGGGGCGGAGGGG + Intronic
968045978 3:195624168-195624190 CTGGCTCTGCAGGAACGGAGGGG - Intergenic
968308676 3:197665919-197665941 CTGGCTCTGCAGGAACGGAGGGG + Intergenic
968509875 4:990919-990941 CTGTGGATGCAGGAGGGGAGGGG - Intronic
969577702 4:8046243-8046265 GTGTGTCCGCAGGGCTGGAGGGG - Intronic
972511356 4:39770897-39770919 CACTGGCCGCAGGAGTGGAGGGG + Intronic
977727641 4:100315532-100315554 CTGTGTCCCCATGAAGGGAGTGG - Intergenic
985069458 4:186153733-186153755 CTGTGTCCGCAGGCACTGAGCGG - Exonic
985300411 4:188482410-188482432 CTATGTCTGCAGGAGGAGAGTGG + Intergenic
985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG + Intergenic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
988516752 5:31911772-31911794 CTGAGTCCCCAGGAGCTGAGGGG + Intronic
988600096 5:32631725-32631747 CTCTGTGCGCAGGATCGGTGAGG + Intergenic
991099931 5:62781107-62781129 ATGGGAGCGCAGGAGCGGAGCGG + Intergenic
993694801 5:91048512-91048534 GTGTGTCCCCTGGAGCTGAGGGG - Intronic
1003098100 6:3157617-3157639 CTGTGGCCGCGGGGGCGGTGCGG + Intergenic
1003571845 6:7261232-7261254 CTGGGTCCGGGGGAGAGGAGTGG + Intergenic
1006136809 6:31900766-31900788 CACTGGCCGCAGGAGTGGAGGGG + Exonic
1007112528 6:39321153-39321175 CTGAGTCGGCAGGTGCGGAGTGG + Intronic
1007630761 6:43272060-43272082 CAGTGCCAGCAGGAGGGGAGTGG - Intronic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1014282667 6:119458961-119458983 CTGTGTCCTCAGTAGGGGTGGGG + Intergenic
1019625689 7:2014632-2014654 CTGTGTCCACAGGAGCGGGACGG - Exonic
1023867147 7:44243730-44243752 CTCTGTCCCCAGGGGCAGAGGGG - Intronic
1024005548 7:45222801-45222823 CTGTGTTCTCAGGAGAGGAAGGG - Intergenic
1024626325 7:51211020-51211042 CTTTGTCCTCAGGAGATGAGAGG - Intronic
1026737992 7:72960979-72961001 CTGGGTGCGCAGGCGTGGAGAGG - Intronic
1027105742 7:75404089-75404111 CTGGGTGCGCAGGCGTGGAGAGG + Intronic
1029118786 7:98252451-98252473 CCCGGTCTGCAGGAGCGGAGAGG + Intronic
1029249513 7:99225897-99225919 ATGGGTGCGCAGGAGGGGAGAGG + Intergenic
1030189440 7:106795748-106795770 CTGAGTCAGCAGGAATGGAGAGG + Intergenic
1033100033 7:138461482-138461504 CTTTGTCCCCAGCAGAGGAGAGG - Intronic
1035118875 7:156548321-156548343 CTGAGACCCCAGGAGGGGAGAGG + Intergenic
1035130103 7:156643569-156643591 ATGTGTCCTCAGGAGCTCAGGGG + Intronic
1035722839 8:1805140-1805162 CTGGGTCCACAGGCGAGGAGAGG - Intergenic
1042059978 8:64806037-64806059 CTGTGTTCTCAGAAGCAGAGAGG - Intergenic
1047429141 8:124775768-124775790 CTGTGAGCTCAGGAGGGGAGAGG - Intergenic
1049724354 8:144138552-144138574 CTCTGTACGCAGGGGCGGGGTGG + Exonic
1050264848 9:3879426-3879448 CTGTGGACGCAGGAGCTGAGAGG - Exonic
1053279814 9:36812667-36812689 GTGGGTCAGCAGGAGCTGAGGGG - Intergenic
1053516452 9:38734575-38734597 CTGTGTCCTCAGGAGCTGTGGGG - Intergenic
1057293270 9:93820475-93820497 CTGCGTCCCCAGGAGGGGTGGGG - Intergenic
1060260560 9:122070485-122070507 CTTTGTCTGCAGGGGCCGAGGGG - Intronic
1060546496 9:124464972-124464994 CAGTGTCCCAAGGAGAGGAGAGG + Intronic
1062246120 9:135567193-135567215 CTGTGCCCCCAGGTGGGGAGGGG + Intergenic
1190260553 X:48794150-48794172 CTGTGCCCTCATGAGCTGAGCGG - Exonic
1192051844 X:67731664-67731686 CTGTTTAGGCAGGAGCTGAGTGG - Intergenic
1193952224 X:87813778-87813800 CTGTGTCCACAGAAGCTGGGGGG + Intergenic
1195966821 X:110436674-110436696 CTGTATCCCCAGGAGAGGATGGG + Intronic
1197428069 X:126323180-126323202 CTGAGTTCCCAGGAGGGGAGGGG + Intergenic