ID: 903260083

View in Genome Browser
Species Human (GRCh38)
Location 1:22126923-22126945
Sequence CTGGTGAGGCAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 698}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903260083_903260094 29 Left 903260083 1:22126923-22126945 CCTTCCTCCATCTGCCTCACCAG 0: 1
1: 0
2: 4
3: 60
4: 698
Right 903260094 1:22126975-22126997 TTCCCTCTCAGACCTCAGGAGGG 0: 1
1: 0
2: 3
3: 14
4: 220
903260083_903260092 25 Left 903260083 1:22126923-22126945 CCTTCCTCCATCTGCCTCACCAG 0: 1
1: 0
2: 4
3: 60
4: 698
Right 903260092 1:22126971-22126993 GTGCTTCCCTCTCAGACCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 223
903260083_903260093 28 Left 903260083 1:22126923-22126945 CCTTCCTCCATCTGCCTCACCAG 0: 1
1: 0
2: 4
3: 60
4: 698
Right 903260093 1:22126974-22126996 CTTCCCTCTCAGACCTCAGGAGG 0: 1
1: 0
2: 12
3: 74
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903260083 Original CRISPR CTGGTGAGGCAGATGGAGGA AGG (reversed) Intronic
900224904 1:1528469-1528491 CGGGTGTGGCAGCTGGAGGGAGG - Intronic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900754280 1:4423031-4423053 CTGGCGAGGGAGATGGAGCAGGG - Intergenic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
901094191 1:6665173-6665195 CTTGGGAGGCAGACGAAGGAGGG - Intronic
901188481 1:7389781-7389803 GTGGTGAGGCCGAGGGAGGAGGG + Intronic
901613120 1:10515064-10515086 CTGGAGAGCCCGCTGGAGGACGG - Intronic
901674852 1:10877156-10877178 TTCTTGAGGCAGAAGGAGGAGGG + Intergenic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902727501 1:18346927-18346949 CTGGTCAGGGAGCTGGAGGAAGG + Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903626881 1:24737052-24737074 CTAGTGAGGCTGAAGCAGGAGGG - Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
904009233 1:27380512-27380534 CTGGTGAGGCCCAGGGAGGGTGG - Intronic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904866170 1:33580647-33580669 CAGGTGAGGCAGATTTAGGAGGG + Intronic
905241748 1:36586133-36586155 CTGGTGAGGCAGATGGACTGGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
905528369 1:38656495-38656517 CTGGTCAGGGAGCAGGAGGAGGG + Intergenic
906375759 1:45295379-45295401 CTTGGGAGGCTGATGCAGGAGGG - Intronic
907653041 1:56314335-56314357 CTGGTGTTGTAGATGGAGGAAGG + Intergenic
907822813 1:57987767-57987789 CTGGTGAAGGAGTTGGGGGAGGG + Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908824947 1:68124319-68124341 CCTGTGAGCCAGATGGAGAAGGG - Intronic
909497181 1:76291308-76291330 CTGGCGTGGCTGATGGAGGTGGG - Intronic
909931213 1:81502353-81502375 GTGATGATGCAGATGGAGGCCGG + Intronic
910058050 1:83055478-83055500 CTGGTGAGGAAGATGTGGGTGGG - Intergenic
910540529 1:88350858-88350880 CTGGTGAGCCAGATGGGGTGGGG + Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911184224 1:94887221-94887243 CTTGTCAGGCAGCTGGAAGATGG - Intronic
912954024 1:114140019-114140041 CGGGTGAGGGTGTTGGAGGAGGG + Intronic
913305338 1:117424692-117424714 AGGCTGAGGCAGATGGAGGATGG - Intronic
913568479 1:120097344-120097366 CTGTTGAGGCAGGTGGTGGGGGG - Intergenic
914289290 1:146258371-146258393 CTGTTGAGGCAGGTGGTGGGGGG - Intergenic
914334671 1:146703575-146703597 CTGGTGAGGCAGAGGAAAAAAGG - Intergenic
914550326 1:148709124-148709146 CTGTTGAGGCAGGTGGTGGGGGG - Intergenic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915149579 1:153819717-153819739 CTAGTGAGCCAGAGCGAGGAAGG - Exonic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
919097150 1:193051250-193051272 CTGGTCAGAAAGATGGGGGAAGG + Intronic
919673116 1:200355827-200355849 CTGGTGAGTGAGAGAGAGGAGGG - Intergenic
920267017 1:204731589-204731611 CTGGTGAGAGAGATGGAGAGAGG - Intergenic
920344029 1:205294414-205294436 ATGGTGAGGAGGATGGAGGCAGG + Intergenic
920415823 1:205798816-205798838 CTGGTGAGCAAGTGGGAGGAGGG + Intronic
922042012 1:221905814-221905836 TTGGTGAGGCTGCTGGAGGGAGG + Intergenic
922322605 1:224501940-224501962 GTGGTGAGGAGGCTGGAGGAAGG + Intronic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
923312554 1:232749035-232749057 CAGGTGGGGCAAATGGGGGAAGG - Intergenic
924014371 1:239704428-239704450 CTGGTGAACCAGATCTAGGAAGG + Intronic
924834770 1:247637177-247637199 CTGATGTGGCTGATGAAGGACGG + Intergenic
1063481906 10:6383671-6383693 CTTGGGAGGCTGATGGGGGAGGG + Intergenic
1065226649 10:23550178-23550200 TTGGTGGGGGAGCTGGAGGAAGG + Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1066341754 10:34541156-34541178 TTAATGAGGCACATGGAGGATGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067412885 10:46079943-46079965 TTGGTGGGGAAGATGGAGGAAGG + Intergenic
1069294171 10:66823488-66823510 GTGGTCAGGCAGCTGGAGGCTGG + Intronic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070394441 10:76000165-76000187 TTGGTGATGGAGGTGGAGGACGG + Intronic
1070680287 10:78444190-78444212 CTGGTGAGGAAGCAGGAGGCAGG + Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073327421 10:102650777-102650799 CTGGGGAGGCAGGTGGGGGTTGG + Intronic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074497370 10:113991911-113991933 TTTGTGAGCCAGGTGGAGGAGGG + Intergenic
1074848624 10:117420915-117420937 CTGGTGAGGCCAGTGGAGTAAGG - Intergenic
1075356261 10:121779706-121779728 GTGGTAAGTCTGATGGAGGAAGG - Intronic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1076302750 10:129440434-129440456 TGGGTGAGGTAGAGGGAGGATGG - Intergenic
1076550645 10:131275824-131275846 CTGGTGGGGCAGATGGCAGTAGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077337507 11:2012016-2012038 CTGGTCTGGCAGAGGGAGGGCGG + Intergenic
1077783270 11:5355131-5355153 CTGTTGAGCCCGATGGAGGTGGG - Intronic
1077824568 11:5791227-5791249 CTTGGGAGGCAAGTGGAGGAGGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081734604 11:45394217-45394239 GTAGTGAGGCTGATGGAGGCAGG + Intergenic
1081794880 11:45812214-45812236 CAGGTGGGGCTGATGGAGCAAGG + Exonic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1083997557 11:66279620-66279642 CAGGTGAGGCACCGGGAGGAAGG - Intronic
1084040296 11:66538906-66538928 ATGGTGCGGCAAATGGAGGCAGG - Exonic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084658808 11:70535373-70535395 CTGGTTAGACTGATGGATGATGG - Intronic
1085299518 11:75450078-75450100 CAGGAGAGGCCGATGGAGCAGGG + Intronic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1087370578 11:97279186-97279208 CTGCTGAGGGACATGGGGGAGGG - Intergenic
1087990502 11:104742187-104742209 CTGGTTAGGCAGATGGATGTAGG + Intergenic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1088409446 11:109517525-109517547 CTGCTGAGGCAGATAGGAGAAGG - Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088734521 11:112717631-112717653 CTGGGGAGGCTGATGGAGATGGG + Intergenic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089068815 11:115682718-115682740 CTGGCTTGGAAGATGGAGGAAGG + Intergenic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089647320 11:119888869-119888891 CTGGTGAGGTGGGTGGTGGAAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1202820491 11_KI270721v1_random:67198-67220 CTGGTCTGGCAGAGGGAGGGCGG + Intergenic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1091584900 12:1810508-1810530 CGTGTGAGGAAGGTGGAGGAGGG - Intronic
1091604109 12:1935787-1935809 CCCGTGAGGCTGATGGGGGAAGG + Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093495808 12:19756018-19756040 CAGGTGAGGGAGATGGGGAAAGG - Intergenic
1093857969 12:24128561-24128583 GTGGTGAGGCAGATGTGAGAAGG + Intergenic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1096345534 12:50842934-50842956 CTGGTGAGCAAGATGGCGGCAGG - Exonic
1096478943 12:51925232-51925254 ATGGTGAGGCAGGGGGAGAATGG + Intergenic
1096659862 12:53117680-53117702 CTGGGGAGGCAGTGGGAGGGTGG + Intronic
1096775099 12:53958812-53958834 CTGGGGAGGCAGCTAGGGGAAGG - Exonic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1100007180 12:89908579-89908601 GTGGTGAGGAAAATGTAGGAAGG + Intergenic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1101653908 12:106702954-106702976 CTGGTGAGGCCTGTGGAGGAGGG + Intronic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103885392 12:124196578-124196600 CTGGTGAGTCAGCTGGGGGCTGG + Intronic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105389453 13:19960176-19960198 CTGGTGAGGCAGCTGGGAGTGGG + Intronic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1107366248 13:39680741-39680763 CTGGCTTGGAAGATGGAGGAAGG - Intronic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1107430696 13:40337837-40337859 CTGGGGATGCACGTGGAGGAAGG + Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107669386 13:42728511-42728533 CTGCTGAGGCAAAAGGAGCAAGG - Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1110261828 13:73493372-73493394 CTGGTGAGTGAGATGAAAGAGGG + Intergenic
1112707311 13:102085241-102085263 CTGGTGGGGGAGGGGGAGGAAGG + Intronic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114548957 14:23522463-23522485 CTGGGGTGGCGGCTGGAGGAGGG + Exonic
1114687093 14:24543585-24543607 CTGGTGAGCCAGGTGGAACAGGG + Intergenic
1114710632 14:24774532-24774554 CTGGTGAGGCAGACGGTGATTGG + Intergenic
1115423038 14:33220207-33220229 CTGCTGAGGATGATGGAGGTAGG - Intronic
1115578587 14:34735971-34735993 CTGGTGAGGGGGATGGTGGTAGG - Intergenic
1117009779 14:51458843-51458865 CTGGTGATGGAAATGAAGGAGGG + Intergenic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118837410 14:69486588-69486610 CTGCTGAGGCAGAAGAAAGATGG - Intronic
1118893726 14:69929233-69929255 TGGGGGAGGCAGATGGAGTAGGG - Intronic
1119444606 14:74652764-74652786 CTGGAGAGGGAGGTGGAGAATGG + Intergenic
1119619057 14:76118088-76118110 CTGGTGAGGCTGAGGAGGGAGGG + Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1120145969 14:80978663-80978685 CAGGTGCTGCAGATGGAGGCTGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1120959461 14:90111239-90111261 CTGGGGTGTCAGATAGAGGATGG + Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121816670 14:96933984-96934006 CTGAGGAGGCACATGGGGGAGGG + Intergenic
1121990409 14:98551661-98551683 CTGGTGGGCAAGTTGGAGGAGGG + Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122603004 14:102930491-102930513 CTGGTGAGGGGGCTGGAGGGGGG + Exonic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1122646007 14:103194666-103194688 CTTGTGGAGTAGATGGAGGAAGG + Intergenic
1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
1122891750 14:104735247-104735269 CTGGTGGGGCAGGTGGAGGCTGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123022927 14:105410692-105410714 CTGGTGAGGGAGGTGGAGGATGG + Intronic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123938636 15:25206062-25206084 CTGGTGAGATAGCTGGAAGATGG - Intergenic
1124941942 15:34226373-34226395 CTGGTGAGCCTGATGAAGAAAGG - Intronic
1127144686 15:56012139-56012161 CTCGTGAGGCTGAGGCAGGAAGG + Intergenic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128524935 15:68406012-68406034 CTGCTGGGTCAGATGCAGGAAGG - Intronic
1128775075 15:70314016-70314038 CTGGTAAGGCTGATAGTGGAAGG - Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129291663 15:74572881-74572903 GTGATGATGCAGATGGAGGCCGG + Exonic
1129711183 15:77820859-77820881 CTGATGAGGCAGTTGGAAGGAGG - Intronic
1129776174 15:78237839-78237861 ATGGTGAGGCAGCTGCAGGGAGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131451576 15:92544666-92544688 CTGGTGAGGCATATTGATAATGG + Intergenic
1131551225 15:93358713-93358735 GGGGCGAGGCAGATGGAGGAGGG + Intergenic
1132496967 16:268475-268497 CTGGTGAGGCACTTGGGGGATGG + Exonic
1132666050 16:1081828-1081850 CTGGGGAGGCAGGTCGAGGGGGG - Intergenic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132869220 16:2108212-2108234 CGGGTGAGGGGCATGGAGGACGG + Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133307641 16:4820917-4820939 ATGGTGGGGCAGGTGGGGGAAGG - Intronic
1133613460 16:7454322-7454344 CTGGTGAAGTAGATGGGGGTGGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1133865438 16:9637629-9637651 CTGGGGAGGCAGGTGGCAGAAGG - Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134420093 16:14078763-14078785 CTGGTGATGGAGATGGTGAAAGG + Intronic
1134550273 16:15135609-15135631 CGGGTGAGGGGCATGGAGGACGG + Intronic
1134911709 16:18033051-18033073 CAGGGGAGGAAGATGGAGGGAGG - Intergenic
1135328981 16:21545636-21545658 CTGGTGTGGAAGGTGGAGGCTGG + Intergenic
1135331627 16:21564831-21564853 CTTGTGGGGCTGATGCAGGAGGG + Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136068272 16:27773137-27773159 CCGGTGAGGCCGATGTAGTAGGG - Exonic
1136118152 16:28108806-28108828 CTCAGGAGGCAGATGGAGGCAGG + Intronic
1136236914 16:28919944-28919966 CTGGTGGGGGAGAGGGAGGGTGG + Intronic
1136339326 16:29631613-29631635 CTGGTGTGGGAGGTGGAGGCTGG + Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1139406504 16:66723223-66723245 ATGTTGAGGGAGGTGGAGGAAGG - Exonic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139998950 16:71007657-71007679 CTGGTGAGGCAGAGGAAAAAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140407607 16:74721486-74721508 CAGGTGAGGGAGATGGAGTAAGG - Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141116572 16:81314818-81314840 CTGGTCAGGCGGGCGGAGGAAGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1142041995 16:87900200-87900222 CTGGTGTGGGAGGTGGAGGCTGG + Intronic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143054756 17:4154607-4154629 CTGCTGAGGCAGGTGTGGGAAGG - Intronic
1143197842 17:5089761-5089783 CTGGGGAGGCTGAGGTAGGAGGG - Intronic
1143473928 17:7192456-7192478 GGAGTGAGGCAGATGGAGAAAGG + Intronic
1143621641 17:8084325-8084347 GAGCTGAGGCAGGTGGAGGAGGG - Intronic
1143779661 17:9222577-9222599 CTGGTGAGGAAAGAGGAGGAGGG + Intronic
1144027303 17:11289458-11289480 GTGGTAAGGGAGATGGAGGATGG - Intronic
1144058042 17:11558981-11559003 ATGGGGAGGCAGCTGAAGGAAGG - Exonic
1144651395 17:17009448-17009470 TTGGTGGGGCTGGTGGAGGATGG - Intergenic
1144797614 17:17903016-17903038 CAGATGAGGCAGGTGGATGAAGG - Intronic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145772661 17:27504693-27504715 CTGCTCAGGCAGATGGCGGCAGG - Intronic
1145903697 17:28505155-28505177 AGGGTCAGGGAGATGGAGGAGGG + Intronic
1145960564 17:28884410-28884432 CTGGTGAGGAAGGTGGAGGGAGG + Intronic
1146579080 17:34021013-34021035 CTGGTGAGGAACATGGAGACAGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147428396 17:40357029-40357051 GTGGTCAGGCAGAGGGAGAAAGG - Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148110640 17:45143256-45143278 CTGGGGAGGAAGATGTGGGAGGG + Intronic
1148132592 17:45270956-45270978 CTGCGGTGGCAGATGGAGCAAGG - Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1148785056 17:50142194-50142216 CTGCTGAGGGAGATGGAGGGTGG + Intronic
1148838060 17:50476826-50476848 CTGCTGAGGCAGCTGGGGGATGG + Intergenic
1149464988 17:56871036-56871058 CTCGGGAGGCTGATGGAGGAGGG + Intergenic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1150227118 17:63530250-63530272 CCGGTGAGGCAGAGTGAGGGTGG + Exonic
1150462424 17:65363910-65363932 GTGGTGGGGGAGAGGGAGGAGGG - Intergenic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151301967 17:73233005-73233027 CTGGTAACGCAGCGGGAGGAGGG + Intronic
1151386852 17:73760258-73760280 CTGGGGAGGCAGGTGGATGCTGG + Intergenic
1151837690 17:76594249-76594271 ATGGTGGGGCAGGTGGAGGGTGG - Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG + Intronic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1152632159 17:81415122-81415144 CGGGCGAGGGAGCTGGAGGAGGG + Intronic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153676001 18:7456117-7456139 CTGGTGATGCAGATGGTGACGGG - Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1156203445 18:34859591-34859613 ATGGTGAGGCAGATGAATAATGG - Intronic
1156462621 18:37329899-37329921 CTGGTGGGGCAGATGAAGATGGG - Intronic
1156519614 18:37711119-37711141 CTGGGGTGGGAGATGGGGGATGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157198070 18:45636130-45636152 CTGGTGAGGGATGTGTAGGAGGG + Intronic
1157208783 18:45723020-45723042 CTCGGGAGGCACTTGGAGGAAGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157516289 18:48314009-48314031 CTGGTGAGGCAGGTGGTGACAGG - Intronic
1157543075 18:48525907-48525929 TTGGTGAGGAAGAAGGAGCATGG - Intergenic
1157886521 18:51372286-51372308 TTGGTGGGGCAGATGGAATAGGG - Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159917360 18:74198944-74198966 CGGGTGAGGGAGCTGGAGGTGGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160386740 18:78501508-78501530 CTGGTGAGGCACTTGGGGGTGGG - Intergenic
1160692456 19:466252-466274 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160692521 19:466493-466515 ATGGTTAGGTAGATGGTGGATGG + Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1162766507 19:12923035-12923057 CTGGTGTGGCTGAAGGCGGAGGG - Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163478976 19:17543339-17543361 CTGGTCAGCCAGCTGCAGGAAGG - Exonic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163833899 19:19562066-19562088 CAGGTGAGGCAGTTGCAGGTTGG + Exonic
1164231916 19:23296885-23296907 TTGCTGAGGATGATGGAGGAAGG + Intergenic
1164558272 19:29269900-29269922 CGGGTGAGGGAGATGGCAGACGG - Intergenic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165824096 19:38695804-38695826 CTGGTGAGGCAGACACAGAAAGG - Intronic
1166116432 19:40658077-40658099 CTCGGGAGGCTGATGCAGGAGGG - Intergenic
1166225391 19:41392011-41392033 TGGGTGAGGCGTATGGAGGAAGG - Intronic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166453744 19:42922909-42922931 CAGGTGAGGCAGAGAGAGGGAGG + Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168236063 19:55063709-55063731 CTGCTGAGTCTGAGGGAGGAGGG + Intronic
1168254401 19:55157830-55157852 CTGGTGATCCAGCTGGAGCAGGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926076980 2:9950499-9950521 CTGGTGGGGCACAGGGAGGCGGG - Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927156101 2:20222747-20222769 CTGGGGAGGCAGGTGGAGTTTGG - Intronic
927274488 2:21250960-21250982 CTGGAGAGTGAGCTGGAGGAAGG + Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928172463 2:29012312-29012334 CTGGTGGGGCAGTTGGCGAAGGG + Intronic
928379715 2:30807314-30807336 CAGGTGTGTCTGATGGAGGAGGG + Exonic
928939327 2:36711874-36711896 CTGGTGAGGCAAATGAAGCCTGG - Intronic
929418984 2:41771667-41771689 CTGGTGAAGCAGATGGGAAAGGG + Intergenic
930345075 2:50169746-50169768 TGGATGAGGTAGATGGAGGACGG + Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931245819 2:60491969-60491991 CTGGAGAGGAAGATGGATGTAGG + Intronic
931784624 2:65608083-65608105 CTGGTGATGCAGGTGGGGCAGGG - Intergenic
931902772 2:66807584-66807606 GAGGTGGGGGAGATGGAGGAGGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932571328 2:72940015-72940037 CTGGTGAGGAAGATGGGGCCTGG - Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935286240 2:101566093-101566115 CTGCTGAGATAGCTGGAGGAAGG - Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935735447 2:106103369-106103391 CTGGTGAGGCAGCCCGAGGCAGG + Intronic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
935919334 2:107994120-107994142 CTGTTGAGGCAGCTGGGAGATGG + Intronic
936264533 2:110992635-110992657 GAGGTAAGGCAGATGGAGCATGG + Intronic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
937079692 2:119131874-119131896 CTGCTGAGGCACCTGGAGAAGGG + Intergenic
937905512 2:127051029-127051051 CTGTTGAGGAAGCTGGAGGCGGG - Intronic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938184580 2:129218450-129218472 CTGGGGAGGGAAATGGAGCAGGG - Intergenic
938192340 2:129295125-129295147 GTAGTGGGGCAGAGGGAGGAGGG + Intergenic
938239605 2:129733203-129733225 TTGGTGAGGCTGGAGGAGGAGGG - Intergenic
939535488 2:143422700-143422722 TGGGTGAGGCAGATGGAAGGTGG + Intronic
939979393 2:148760130-148760152 CTACTGAGGCTGAGGGAGGAGGG + Intronic
940737223 2:157467080-157467102 ATGGTGAGGCAGCTGGAGGTGGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941134968 2:161703859-161703881 CTGTTGAGGCAGATGTTGTAGGG - Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
946179629 2:217941775-217941797 CTGGTGGGTCAGCAGGAGGATGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946382466 2:219358481-219358503 CTGGGGAGGCGGCTGGGGGAGGG - Intergenic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948944429 2:241212297-241212319 GTGCTCAGGCAGGTGGAGGACGG + Intronic
949006674 2:241653383-241653405 CAGGTGGAGCTGATGGAGGAGGG + Intronic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169674266 20:8135866-8135888 CTGGTGAGGTAGACAGTGGAAGG + Intronic
1170555145 20:17508941-17508963 CTGCGGAGTCAGCTGGAGGAGGG - Exonic
1170785275 20:19462247-19462269 GTGGGGAGGCAGATGGCGGGTGG + Intronic
1170793477 20:19526636-19526658 ATAGTGGGGGAGATGGAGGAAGG - Intronic
1171196824 20:23206319-23206341 CTGGTGAGGCTGATGGCCCAGGG + Intergenic
1171455565 20:25270067-25270089 CTGCTGAGGGAGAGGGATGATGG - Intronic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172012110 20:31851551-31851573 GTGGTGCTGCAGATGGAGGGAGG + Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172536661 20:35678749-35678771 CTGGTGAGGCTGGGGTAGGAGGG + Intronic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1173458897 20:43225962-43225984 GGGGTGAGGCAGTGGGAGGAGGG - Intergenic
1174550967 20:51361257-51361279 CTGGCTTGGTAGATGGAGGAAGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1175344197 20:58259800-58259822 CAGGTGTGGCAGATGGAGAGGGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175495971 20:59414503-59414525 CTGGCTTGGAAGATGGAGGATGG - Intergenic
1175594726 20:60221904-60221926 CTGGTGAGGAGGATGCAGGGAGG + Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1176257268 20:64158869-64158891 CAGGTGGGGCAGGTGGAGGTAGG - Intronic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1177813816 21:25953893-25953915 CTGGTGAGGCATGTGGGTGATGG + Intronic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178602807 21:34009538-34009560 CTGGTGAGGTAGAGAGAGAAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179727460 21:43348409-43348431 CTGATGTGGCAGAGGCAGGAAGG - Intergenic
1179812018 21:43877889-43877911 GGGGTGTGGGAGATGGAGGAAGG - Intronic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1181046104 22:20215046-20215068 CTGATGAGGCAGGTGGATGGTGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1182428250 22:30286099-30286121 CTGGGGAGGGAGATGGGTGATGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183409648 22:37647346-37647368 CAGGTGAGGATGTTGGAGGAGGG + Exonic
1183711175 22:39504381-39504403 CGGGAGAGGCAGCTGGAGAAGGG + Exonic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184651321 22:45920622-45920644 CTGGTTCGGGAGATGGGGGATGG + Exonic
1185074488 22:48676001-48676023 CTGCTGAGGCAGCTGGCGGTGGG + Intronic
949541882 3:5038919-5038941 CTTGTGAGGCTGAGGCAGGAAGG + Intergenic
949726124 3:7047447-7047469 CTGGTGAGAGAGATGGTGGTTGG - Intronic
950773205 3:15328630-15328652 CTGGGGAGGATGATGCAGGAGGG + Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
952832484 3:37576709-37576731 CTCGGGAGGCTGAGGGAGGATGG - Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953101152 3:39829553-39829575 CTGGTGAGGCTGCTGGAAGTGGG + Intronic
953431493 3:42844250-42844272 GAGGTGAGGCAGAGGAAGGAAGG + Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954001270 3:47559027-47559049 TGGGTAAGGCAGATTGAGGATGG - Intergenic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954841671 3:53516814-53516836 CAGGTGAGGCAGATGAAGCTAGG + Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
959077052 3:101760304-101760326 CTTATGAGGAAAATGGAGGAGGG + Intronic
959259445 3:104056511-104056533 CTGGTGAGGAAGTTGGGGAAAGG + Intergenic
959301758 3:104611386-104611408 CTGTTGAGGAAGGTGGAGAAAGG - Intergenic
960326683 3:116304846-116304868 TTGGTGGGGAAGATGGAGGATGG + Intronic
961166459 3:124766980-124767002 TTGCTGAGGCAGCTTGAGGAAGG - Intronic
961349488 3:126290539-126290561 CTTGTGAGACAGAGGAAGGAAGG - Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962292487 3:134148151-134148173 CAGGGGAGGAAGATGTAGGATGG - Intronic
962406152 3:135101922-135101944 CTGGTGAGGGAGGTGGACAATGG - Intronic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
963353711 3:144183908-144183930 GTGGTGAGGAAGATGGAAGTAGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
966435126 3:179875497-179875519 CAGGTGAGGCAGGTGGCGGCAGG + Intronic
966624964 3:182005860-182005882 CTGGAGAGGCAGCTCGAGGCAGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967367279 3:188701556-188701578 CTTGTGAGGCACAGGAAGGATGG - Intronic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
968091013 3:195898196-195898218 CTGGTGGAGAAGGTGGAGGACGG - Intronic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968376956 4:51748-51770 CTGGTTAGGCAGATAGAGAGAGG + Intergenic
968431205 4:560183-560205 CATGTGAGACAGATTGAGGATGG + Intergenic
969130058 4:4984402-4984424 CAGGTGGGGCAGGTGGGGGAAGG + Intergenic
969500685 4:7550857-7550879 CGGGTGAGACAGATGGAAAAAGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
970625718 4:17877546-17877568 CTGGTGTGAGAGATGGAGGCTGG + Intronic
971041032 4:22752439-22752461 CTAGGGAGTCAGATGGATGATGG + Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971422707 4:26488801-26488823 AGGGTGAGGATGATGGAGGAGGG - Intronic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972974394 4:44615747-44615769 CTTGTGAGACAGATTGAAGATGG - Intergenic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
973630032 4:52811624-52811646 CTGGTGAAGGAGTTGGAGGGAGG + Intergenic
973991919 4:56417676-56417698 CTTGTGAGGCTGAGGCAGGAAGG + Intronic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974482013 4:62457241-62457263 ATGGTGAGGAAGATGAAAGAAGG + Intergenic
974540347 4:63225730-63225752 CTGGTGAGGCAGTGGGAAAAGGG + Intergenic
975728186 4:77312864-77312886 CTTGTGAGGGAAATAGAGGAGGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977568513 4:98607010-98607032 GTGGTGAGGCAGTTGGGGGAAGG + Intronic
978705308 4:111702008-111702030 CTAGTGAGGAAGATGGAGAGGGG - Intergenic
980394475 4:132192533-132192555 GTGGGGAGGCAGATGAAGTAGGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
981054792 4:140349745-140349767 CTGGTGAGGGAGGTGGTGGCAGG - Intronic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982206182 4:152998914-152998936 CTGGGGAGGAAGGTGGAGGGAGG + Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
983891446 4:173034269-173034291 GCAGTGAGGAAGATGGAGGAGGG - Intronic
985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985575688 5:672489-672511 CCGATGAGGCAGAGGAAGGAGGG - Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985818492 5:2144391-2144413 CTGTTGAGGGAGAGGGAGGTGGG - Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986011077 5:3715853-3715875 ATGGGGAGGCAGGTGGACGAGGG - Intergenic
986639713 5:9860369-9860391 CTGGGGAGGGAGATGAGGGAAGG - Intergenic
986767923 5:10944642-10944664 GTTGTCAGGGAGATGGAGGAAGG + Intergenic
987371879 5:17201022-17201044 CTGGTGAGGAAAATGAAGCAGGG + Intronic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
990446126 5:55896386-55896408 CAGCTGAGGCGGATGGAAGAAGG + Exonic
990780171 5:59351946-59351968 CTGGTGAGGAAGCTGGAGGTGGG + Intronic
990799554 5:59585049-59585071 CTGGTGATGCAGTTGGAAGTGGG + Intronic
991117198 5:62968435-62968457 CTGATGATGCAGGTGGAGGGAGG - Intergenic
991297055 5:65092862-65092884 TTGGGGTGGCAGATGGGGGAGGG - Intergenic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
995707956 5:115004648-115004670 CTGGTGAGGAGGTTGGAGAAGGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996618556 5:125471660-125471682 CTGGTGAGGGAGTTGGGGAAAGG - Intergenic
996819012 5:127605156-127605178 CTGGTGCTGAAGATGGTGGAAGG - Intergenic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997434390 5:133863986-133864008 CAGCTGTGGCAGCTGGAGGAAGG - Intergenic
997526256 5:134555116-134555138 CTGGGGTGGCAGCTGGGGGAGGG - Intronic
997815239 5:137010599-137010621 CTGGTGAGGGAACTGGAGGCTGG - Intronic
997823890 5:137089425-137089447 CTGGTGTGGGAGGAGGAGGAGGG - Intronic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
1000138971 5:158382640-158382662 CTGGTGAGTCAGCTGGGGGCTGG + Intergenic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001753673 5:174150218-174150240 TTGTTGAGACGGATGGAGGAAGG - Intronic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1001931033 5:175673088-175673110 CTGGTGAGGTAGAAGCAGGCAGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1002862564 6:1093370-1093392 CTGGGGAGGTAGGTGGAGCAAGG - Intergenic
1003408537 6:5843101-5843123 CTGGTGTGGCAAATGGGGGTGGG + Intergenic
1003420343 6:5952229-5952251 ATGGTGGGGCAGATGAAGTAGGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004222034 6:13755608-13755630 CTGGTGTGGGGGGTGGAGGAAGG - Intergenic
1005831758 6:29676719-29676741 ATGGTGCGGGAGATGGAGAAAGG + Intronic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006149890 6:31981364-31981386 CTGGGGAGGCTGGTGAAGGAGGG + Exonic
1006156191 6:32014102-32014124 CTGGGGAGGCTGGTGAAGGAGGG + Intergenic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006794448 6:36722677-36722699 CTGGTGCAGCAGGTGCAGGAAGG - Exonic
1007252204 6:40503421-40503443 CTGGTGCAGCCGATGGAGGGCGG + Intronic
1007697756 6:43744516-43744538 CTGGTTAGGGAGATGGAGCTTGG + Intergenic
1007834825 6:44666345-44666367 CTGGTGGGGAGGCTGGAGGAGGG + Intergenic
1008243388 6:49141448-49141470 CTCGTGAGGCTGAAGCAGGAGGG - Intergenic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010097888 6:72068215-72068237 TTTGTGAGGCAGATGGAACATGG - Intronic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012402146 6:98849544-98849566 GGGGTGGGGGAGATGGAGGAAGG - Intergenic
1013305248 6:108841689-108841711 CAGATGAGGCAGTTTGAGGAAGG - Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017798408 6:157869186-157869208 CTCGTGAGGCAGAGAGGGGAGGG - Intronic
1018062790 6:160103651-160103673 CTGGTGGTGCAGATGGGGGTGGG + Intronic
1018109192 6:160519234-160519256 CTAGTGTGGCAGATGGAGCAGGG + Intergenic
1018126378 6:160686490-160686512 CTAGTGTGGCGGATGGAGCAGGG - Intergenic
1018134758 6:160768330-160768352 CTTGTGTGTCAGATGGAGCAGGG - Intergenic
1018150106 6:160930063-160930085 CTTTTGTGGCAGATGGAGCAGGG + Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018342057 6:162861635-162861657 GTGGTGAGGCAGAGGGAGGTGGG - Intronic
1018435127 6:163752433-163752455 CTGGTGAGGGAGAGAGAGGCCGG - Intergenic
1018440284 6:163806151-163806173 GTGGTGAGGCCAGTGGAGGAGGG + Intergenic
1018699547 6:166415913-166415935 ATGGTGGGGGTGATGGAGGAAGG - Intronic
1018726468 6:166616654-166616676 CTGGCCTGGCAGAGGGAGGATGG - Intronic
1019777324 7:2919579-2919601 CTGGTGAAGGACATGGAGGACGG - Exonic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020262057 7:6536261-6536283 CTGGGGAGGCTGCTGGAGGAAGG - Intronic
1020445014 7:8259866-8259888 CTGCTGAGGCAGATTGCGAATGG + Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023612232 7:41982592-41982614 CTTGTGAGGCTGAGGCAGGAGGG + Intronic
1024460611 7:49655917-49655939 ATGGTGAGGCTGAGGGAGAAGGG + Intergenic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1025870510 7:65428183-65428205 TTGCTGAGGATGATGGAGGAAGG - Intergenic
1025944707 7:66096910-66096932 CTGGTCTTGCAGATGGAAGAAGG - Intronic
1026085873 7:67262574-67262596 CTGGTCAGGTGGATGGAGGTAGG - Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026691293 7:72552300-72552322 CTGGTCAGGTGGATGGAGGTAGG + Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027052447 7:75028732-75028754 CTGGAGATGCCCATGGAGGAAGG - Intronic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1029169455 7:98620416-98620438 GAGGTGGGGCAGATGGAGAAGGG + Intronic
1029363829 7:100104938-100104960 CTGGTGAGGCATCTGCAGGCAGG + Exonic
1029744039 7:102506869-102506891 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029762029 7:102606032-102606054 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029925042 7:104306618-104306640 CTAGTGAGGTAGATTGCGGAGGG - Intergenic
1030171000 7:106602713-106602735 GGAGTGAGGCAGATGGAGGCAGG + Intergenic
1030284450 7:107811428-107811450 CTGGTGTTGAAGATGCAGGAAGG - Intergenic
1031333310 7:120494171-120494193 CTGGTGGGGAAGGTGGAAGATGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031739225 7:125407817-125407839 CTGGTGTTGCAAATGGAAGAAGG + Intergenic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1031970140 7:128058871-128058893 CTGCTGAGACAGATCGGGGATGG - Intronic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032544148 7:132727927-132727949 CTAGTGGTGCAGGTGGAGGAAGG - Exonic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1033175320 7:139118480-139118502 ATGGTCAGACAAATGGAGGAAGG + Intergenic
1033463945 7:141573726-141573748 CTTGTGAGGCAGAGGGACGTGGG + Intronic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035768308 8:2126656-2126678 CGGGAGAGGCTGATGGAGGCTGG + Intronic
1035836107 8:2753863-2753885 TTGGTGAGGCAGATGAAGCAAGG + Intergenic
1036037158 8:5031969-5031991 CAGGTGAGGCAGGTGGTGAAGGG + Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037615074 8:20511867-20511889 CTGGTAAGGCATCTGAAGGAAGG - Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1039507720 8:38064065-38064087 TGGGTGAGGTAGAGGGAGGAGGG + Intergenic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1039920899 8:41893924-41893946 CTGGTGAGGCAGAGGGCCTAGGG - Intronic
1039963022 8:42264262-42264284 CTGGGGAGGCTGAGGTAGGAGGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040880392 8:52198872-52198894 CTGGTGTTGCATGTGGAGGAAGG - Intronic
1041411363 8:57560218-57560240 CTGGGGAGGCTGATGTAGAAGGG - Intergenic
1043810529 8:84733422-84733444 TTGATGAGGTAGATGGATGAGGG - Intronic
1044928212 8:97227174-97227196 CTGGGGATGGAGATGGATGATGG - Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045400445 8:101811315-101811337 TTGGCTAGGAAGATGGAGGAAGG + Intronic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1045661396 8:104441582-104441604 CTGGTGCCGAAGATGGAGGAAGG + Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046476723 8:114755075-114755097 CTGCTGATGCAAATGGTGGAAGG + Intergenic
1046654865 8:116882307-116882329 CTTGGGAGGCAGAGGTAGGAGGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047347464 8:124042078-124042100 GTGTTGTGGCAGGTGGAGGAGGG - Intronic
1048072903 8:131040367-131040389 TTGGGGAGGCAGCCGGAGGAGGG + Exonic
1048945703 8:139445235-139445257 CTGGTGGGGCTGGTGGATGAAGG - Intergenic
1050377414 9:4987005-4987027 AAGGTGAGGCGGATGGGGGAAGG - Intronic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052037172 9:23695907-23695929 GAAGTGAGGGAGATGGAGGATGG - Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056889950 9:90482635-90482657 CAGGTCTGGCAGATGTAGGAAGG + Intergenic
1057050496 9:91919970-91919992 CTGGTGGGGCAGGTGTGGGATGG - Intronic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059352709 9:113676940-113676962 CTGGGGGGGCAGGTGGAGGTGGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060578416 9:124720157-124720179 CTTGGGAGGCTGATGGAGGCAGG - Intronic
1060789973 9:126479316-126479338 CAGGTCAGGCAGATGGTGGTGGG + Intronic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1061056387 9:128224995-128225017 ATGGTGGGGCAGATGGGAGAAGG - Intronic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061334620 9:129923963-129923985 AGGGTGAGGCAGAGGCAGGAGGG + Exonic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061648678 9:132028066-132028088 CTGGTGAGGCAGGTGGAAGGAGG - Intronic
1062160464 9:135076792-135076814 ATTCTGAGGGAGATGGAGGAAGG - Intronic
1062178603 9:135178565-135178587 CTGGTGAGGAAGCTGGAGTTTGG + Intergenic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1062376262 9:136263181-136263203 GGGGTGGGGCAGATGGAGGGAGG - Intergenic
1062520415 9:136955348-136955370 CTGGTGGGGGAGATGGAGTCGGG - Intronic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203572280 Un_KI270744v1:142498-142520 CTGGTTAGGCAGATAGAGAGAGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186804832 X:13130034-13130056 CTGCTGAGGCAGTTGCAGGTGGG - Intergenic
1189071851 X:37872126-37872148 CTGGTGAGTCAGCTGGTGGCTGG + Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192175059 X:68880280-68880302 GTGGTGGGGCAGGTGGGGGATGG - Intergenic
1193526650 X:82598611-82598633 CTGGTGAGTGGGATGGGGGAAGG - Intergenic
1193938741 X:87654289-87654311 ATAGTGAGGCAGGTGGAGGGTGG - Intronic
1195513317 X:105742892-105742914 ATGGTGATGGAGATGGAGAAGGG - Intronic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197277132 X:124492804-124492826 CTGGTGGGGCAGTGGGAGGCAGG + Intronic
1197753149 X:129979618-129979640 CGAGTGAGGAAGAAGGAGGAAGG - Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1198102763 X:133436309-133436331 AGGGTGAAGCAGATGGAGGGTGG + Intergenic
1198839213 X:140838713-140838735 CTAGTGGGCCAGATGGAGTATGG - Intergenic
1199480326 X:148291454-148291476 TTGGAGAGGCAGGTGTAGGAAGG - Intergenic
1199710012 X:150462287-150462309 CTGGTGAGGCACATAGGAGAGGG + Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic