ID: 903260936

View in Genome Browser
Species Human (GRCh38)
Location 1:22131655-22131677
Sequence GATTTGCTGTGTGATGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903260933_903260936 -6 Left 903260933 1:22131638-22131660 CCAAGAGGAATGCCCGTGATTTG 0: 1
1: 0
2: 0
3: 10
4: 67
Right 903260936 1:22131655-22131677 GATTTGCTGTGTGATGCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
903260932_903260936 5 Left 903260932 1:22131627-22131649 CCAGAGGGCTGCCAAGAGGAATG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 903260936 1:22131655-22131677 GATTTGCTGTGTGATGCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 105
903260931_903260936 6 Left 903260931 1:22131626-22131648 CCCAGAGGGCTGCCAAGAGGAAT 0: 1
1: 0
2: 0
3: 21
4: 206
Right 903260936 1:22131655-22131677 GATTTGCTGTGTGATGCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903260936 Original CRISPR GATTTGCTGTGTGATGCACC TGG Intronic