ID: 903261706

View in Genome Browser
Species Human (GRCh38)
Location 1:22135097-22135119
Sequence GCTGCTAGGACATCAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903261697_903261706 20 Left 903261697 1:22135054-22135076 CCTCTGAGGCTGGGGAGTGTGAG 0: 1
1: 0
2: 4
3: 48
4: 375
Right 903261706 1:22135097-22135119 GCTGCTAGGACATCAAGAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
903261696_903261706 21 Left 903261696 1:22135053-22135075 CCCTCTGAGGCTGGGGAGTGTGA 0: 1
1: 0
2: 0
3: 36
4: 274
Right 903261706 1:22135097-22135119 GCTGCTAGGACATCAAGAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903261706 Original CRISPR GCTGCTAGGACATCAAGAGC TGG Intronic
900043380 1:489649-489671 GCTGCTAGGGCAGCATGGGCAGG + Intergenic
900850638 1:5139960-5139982 GCTTCAAGGACATCCATAGCTGG + Intergenic
902476600 1:16691759-16691781 GCTGCAATGACATCAGGGGCAGG + Intergenic
903261706 1:22135097-22135119 GCTGCTAGGACATCAAGAGCTGG + Intronic
904487142 1:30833419-30833441 GCTACTGGGGCATCAAGAGACGG + Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
914339183 1:146743697-146743719 CCTGATAGGACCTCAAGCGCTGG - Intergenic
915461346 1:156072374-156072396 GTTTCTAGGACAAAAAGAGCAGG + Exonic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
1070425903 10:76286861-76286883 GCTGCTATGACATTATGGGCTGG - Intronic
1072033229 10:91540948-91540970 GCTGCTATGACTTGAAGACCAGG - Intergenic
1073135128 10:101216081-101216103 GCTGCTAAGACCTCCGGAGCCGG - Intergenic
1074415139 10:113261068-113261090 CCACCTAGGACTTCAAGAGCTGG - Intergenic
1076055673 10:127370327-127370349 GCTCCGAGGTTATCAAGAGCCGG - Intronic
1076755750 10:132570804-132570826 GCTGCCAGGACAGCAGGAGGTGG + Intronic
1079712270 11:23700218-23700240 GCTGCAAGGCCATTAAAAGCAGG + Intergenic
1086234100 11:84607022-84607044 GATCCAAGGTCATCAAGAGCAGG + Intronic
1090064555 11:123491798-123491820 GCAGCTGGGACCTCAAGGGCTGG - Intergenic
1090626123 11:128610467-128610489 GCTGCTAGAACATCAGAAGGTGG + Intergenic
1091670777 12:2450732-2450754 ACTGCCAGGACTTCAAGAGAGGG - Intronic
1094535090 12:31314105-31314127 GGTGGAAGGACAACAAGAGCAGG + Intronic
1097193025 12:57229020-57229042 ACTCCTGGGACATCAAGAGGTGG + Intergenic
1097707767 12:62885363-62885385 GTTGCTAGGACAGCAAAAGAGGG + Intronic
1104212989 12:126708230-126708252 GATGGTAGGACATCAAGATCTGG - Intergenic
1106289938 13:28351286-28351308 CCTGTTAGGACCTCAAGAGAAGG + Intronic
1108702199 13:52953236-52953258 CCTGATAGGACCTCAGGAGCTGG - Intergenic
1114260449 14:21032747-21032769 GCTGCCAGGATTCCAAGAGCAGG + Intronic
1118682595 14:68258881-68258903 TCTTCTAGAATATCAAGAGCAGG + Intronic
1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG + Intergenic
1126494043 15:49270928-49270950 GCAGTTAGGACCTCAAGAGTGGG + Intronic
1128259439 15:66222287-66222309 GCAGCTGGGAAATCAGGAGCAGG - Intronic
1129456191 15:75677223-75677245 GCTCCTCGGACACCAACAGCTGG + Exonic
1131877811 15:96829224-96829246 GCTGATTGGACCTCATGAGCAGG - Intergenic
1132987649 16:2776471-2776493 GCTTCTAGGACATCAGCAGGAGG + Intronic
1134396075 16:13864701-13864723 TCTGCTATGCCATCAAGAGTAGG - Intergenic
1135551324 16:23400446-23400468 GCTTCCAGGAGACCAAGAGCAGG + Intronic
1136068330 16:27773394-27773416 CCTGCTAAGACATCAGGAGCAGG + Intronic
1139995095 16:70973655-70973677 CCTGATAGGACCTCAAGCGCTGG + Intronic
1142561138 17:809652-809674 GGTTCTAGGACAGAAAGAGCTGG + Intronic
1144638882 17:16926907-16926929 GCTCCTATCACATCAGGAGCAGG - Intergenic
1155871232 18:31030972-31030994 GCTGCTAGAACATCAGAAGAAGG - Exonic
1160551832 18:79698371-79698393 GTTGCTAGGATGTCAAGGGCAGG + Intronic
1162725962 19:12689841-12689863 CCTGGTAGGACATGCAGAGCAGG + Exonic
1163229346 19:15989728-15989750 GCTGCTAGGACAGAAAGACCTGG - Intergenic
1163409526 19:17145375-17145397 CCTGCAAGGAAATCAAAAGCAGG - Exonic
1163582646 19:18147603-18147625 CCTGCTGGGACATCAGGGGCTGG - Exonic
1163740794 19:19010597-19010619 GTTTCCAGGCCATCAAGAGCTGG - Intronic
1167081057 19:47276253-47276275 GCTGCTAGGAAACCAAGGCCGGG + Intergenic
1167867102 19:52337230-52337252 GGTGCTGGGACAGCAAGAGGGGG + Intronic
1202710621 1_KI270714v1_random:17600-17622 GCTGCAATGACATCAGGGGCAGG + Intergenic
926314167 2:11697298-11697320 GCTGCCAGGAGCACAAGAGCTGG - Intronic
927755155 2:25702396-25702418 GCAGCTATGACATAAAGAACTGG + Intergenic
930016667 2:46975436-46975458 GCTTCTGGGACACCGAGAGCAGG - Intronic
931038190 2:58266527-58266549 GCTGATAGGATATGAAGATCAGG + Intergenic
933651066 2:84850675-84850697 ACTGCTTGGCCATCAGGAGCTGG - Intronic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
941454820 2:165702792-165702814 CCTGCTAGGACTTCAGGACCTGG + Intergenic
944595202 2:201254866-201254888 GCTGCAGGGACATGGAGAGCTGG - Intronic
948107631 2:235428011-235428033 GCTGCCAGGAAATCCAGAGATGG - Intergenic
948671347 2:239570735-239570757 GCTGCGGGGACATCCACAGCAGG - Intergenic
1173527156 20:43741905-43741927 GCTGCTAGGCCATCAAATGCTGG + Intergenic
1179913913 21:44464352-44464374 GCTGCAAGGACAACGAGGGCTGG - Intergenic
1180184558 21:46132974-46132996 CCTCCTAGGACATCAACTGCAGG + Intergenic
1180693699 22:17738708-17738730 GCTGCTGGGACATCACAGGCTGG + Intronic
1184104611 22:42360171-42360193 GCTGGGAGGACAGCAAGAGTAGG - Intergenic
1184320532 22:43739240-43739262 GCTGCTGGGACAGCAAGATGAGG - Intronic
954221455 3:49157003-49157025 GCAGCTAGGACAACAGGTGCAGG + Intergenic
957159850 3:76596637-76596659 GCTACTAGGCCATCAACAGCAGG + Intronic
964402186 3:156311079-156311101 GCTACTGGCACATTAAGAGCAGG - Intronic
968879420 4:3291662-3291684 TCTGCTGGGTCATCAAGGGCTGG + Intergenic
969491644 4:7502568-7502590 GGAGCCAGGACATCAAGAGGAGG - Intronic
973048067 4:45561061-45561083 GCTGCTAGAAAATCTAGAGTTGG + Intergenic
978149329 4:105414972-105414994 GCAGAGAGGACATCCAGAGCGGG + Intronic
980761377 4:137238586-137238608 GCTGCTAAGTCCACAAGAGCAGG - Intergenic
981247952 4:142562530-142562552 GCTTCAAGGAGACCAAGAGCAGG + Intronic
988297989 5:29390807-29390829 GTGGCTAGGACAGCAGGAGCGGG - Intergenic
992956247 5:81911540-81911562 GCTGCTAGGGGAGCAAGGGCTGG - Intergenic
998118007 5:139553234-139553256 GCAGCTAGGAAATCAATAACAGG + Intronic
1000177541 5:158772406-158772428 GTTGCTAGGACCTCCAGAGGAGG + Intronic
1000947929 5:167445427-167445449 GCTGCATGCACATCAAGGGCAGG - Intronic
1002150946 5:177230434-177230456 GCTGCAAGGAAATAGAGAGCTGG + Intronic
1002358416 5:178649892-178649914 GCTGCTTGGAGAGCAAGAGGAGG + Intergenic
1002730463 5:181329280-181329302 GCTGCTAGGGCAGCATGGGCAGG - Intergenic
1010427379 6:75742475-75742497 GCTGCCAGGTCATGAAGAGAAGG + Intergenic
1017549670 6:155492788-155492810 GCTGGCAGGACACCAGGAGCTGG + Intergenic
1017662814 6:156690474-156690496 GCTGCTAGGACATGAACATTTGG - Intergenic
1019227971 6:170530756-170530778 GCTGCTAGGAACTCCAGAGGAGG + Intergenic
1022651738 7:32283669-32283691 GCTGCTATGACAACAAGAGGAGG + Intronic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024426478 7:49232026-49232048 GCTGCTAGGATTGCAAGAGAGGG + Intergenic
1024484507 7:49902707-49902729 GTTGTTAGGACATCAAAAGCAGG + Intronic
1029464327 7:100715931-100715953 TCTGCTAGAAGATGAAGAGCAGG + Intergenic
1029952828 7:104604832-104604854 GCTGCTAGGCCATGCAGAACTGG + Intronic
1031134653 7:117872732-117872754 GCTGCTAGGACCTAAAGCGCTGG + Intronic
1033799576 7:144884365-144884387 GCTGAAAAGACATCAAGAACAGG - Intergenic
1038207130 8:25477182-25477204 GCTGCTAAGACATCAAGGAAAGG - Intronic
1044295544 8:90522928-90522950 GCAGCTAGGGGATCAAGTGCAGG + Intergenic
1044424190 8:92032151-92032173 GCTGCTAGTACATGAATAGATGG + Intronic
1056607413 9:88097756-88097778 GATGATAGGAGATCAAGAACTGG - Intergenic
1056762561 9:89425624-89425646 GCTGCTTTGACATCAGGGGCAGG + Intronic
1057024360 9:91724259-91724281 GCTTCAAGGACATCCACAGCCGG - Exonic
1058295074 9:103295916-103295938 GCTCCTACGACATCATGATCTGG + Intergenic
1058312846 9:103527302-103527324 AATGCTAGGACAGCAAGAGTAGG - Intergenic
1058732019 9:107859508-107859530 GAGGCTAGGTCATCAAGATCAGG + Intergenic
1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG + Intergenic
1195630502 X:107050851-107050873 GCTGGGAGGACATCAAGGGAGGG + Intergenic
1196033566 X:111117975-111117997 GCTGCTAGGAGACCCAGATCTGG + Intronic
1198078929 X:133220265-133220287 GGTGATTGGATATCAAGAGCAGG + Intergenic
1199848468 X:151708483-151708505 GCTGATAGGACATCTAGGGGTGG + Intergenic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic