ID: 903262532

View in Genome Browser
Species Human (GRCh38)
Location 1:22139137-22139159
Sequence TGGGACAGCCTGGGATAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903262522_903262532 14 Left 903262522 1:22139100-22139122 CCTAGGATCCTACCTGTGTTAAA 0: 1
1: 0
2: 6
3: 22
4: 104
Right 903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 195
903262524_903262532 6 Left 903262524 1:22139108-22139130 CCTACCTGTGTTAAATCAGTGGA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 195
903262525_903262532 2 Left 903262525 1:22139112-22139134 CCTGTGTTAAATCAGTGGATCTG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG 0: 1
1: 0
2: 2
3: 8
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903262532 Original CRISPR TGGGACAGCCTGGGATAAAC AGG Intronic
901645161 1:10712970-10712992 AGGGAAAGCCTGGAATAACCAGG + Intronic
903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG + Intronic
906041132 1:42788551-42788573 TGGGAGAGACTGGGAGAGACTGG + Intronic
909101279 1:71352390-71352412 AGGGACAGCATGGGGAAAACTGG - Intergenic
910335119 1:86119545-86119567 TGAGACAGCCTGTGATACAAAGG + Intronic
911056422 1:93712238-93712260 TGGGACAGGCTGGGTGAACCAGG - Intronic
911573620 1:99548250-99548272 TGGGAAAACCTGGGAAAACCTGG - Intergenic
913334083 1:117692479-117692501 TGGTACAACCTGTGATACACAGG - Intergenic
915460645 1:156068634-156068656 TGGGACATCATGGGAGACACAGG - Intronic
916060503 1:161095239-161095261 GGGGACAGCCTGGGAGACATGGG + Intergenic
917209396 1:172616179-172616201 TGGGACAGCCAAGTATAAAGGGG + Intergenic
921051962 1:211517285-211517307 TGGGAGAACCTGGGCTCAACAGG - Intergenic
923035744 1:230283931-230283953 GGGGACAGCCTGGGAGGAAGAGG + Intergenic
923632191 1:235658559-235658581 TGAGACAGTTTGGGACAAACTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1075926207 10:126253765-126253787 GGGCAGAGCCTGGGATAAGCAGG + Intronic
1076111277 10:127861517-127861539 TGGGACATCCTGGGATGCCCTGG + Intergenic
1076941957 10:133615927-133615949 GGGGACAGCCTGGAATAACTGGG - Intergenic
1077498115 11:2896508-2896530 TGGGACAGCTCCGGACAAACTGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080120629 11:28673350-28673372 TGGGACAGCATGGGATACAGTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1090157605 11:124458158-124458180 TAGGACAGGCAGGGATAAGCAGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096604478 12:52754807-52754829 TGGCTCAGCCTGGGATATTCTGG - Intergenic
1096738761 12:53676714-53676736 TGGGACAGTCTAGGAATAACGGG + Intronic
1099039973 12:77640564-77640586 TGGGACAACATGGATTAAACTGG - Intergenic
1099636060 12:85213455-85213477 AGGGACAGGCTTTGATAAACTGG + Intronic
1104143897 12:126013893-126013915 TGGGCCAGAATGGGATCAACTGG + Intergenic
1104404628 12:128507172-128507194 TGGGACAGCCTGGGTTGGTCAGG - Intronic
1105246807 13:18660129-18660151 TGGCACAGAATGGGATAAAAAGG - Intergenic
1105643042 13:22285839-22285861 TGGGGCAGACTGCGAGAAACAGG + Intergenic
1106587464 13:31069785-31069807 TGGGACAGCCTAGTATCAAAGGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107518663 13:41157832-41157854 TCTGACAGCCTGGGATCCACTGG - Intergenic
1107616995 13:42180241-42180263 TGCTAAAGCCTGGGACAAACTGG + Intronic
1110963515 13:81660809-81660831 TGGGACAGCCTGGGTGACAGAGG + Intergenic
1111847030 13:93523937-93523959 TGTGGCAACCTGGGAAAAACAGG + Intronic
1112290222 13:98139810-98139832 TGCCACAGCTTGGGATAAAAGGG + Intergenic
1113869702 13:113551711-113551733 TGGGTCAGCATGGGACAAACGGG - Intronic
1114220893 14:20695419-20695441 AGGGATAAACTGGGATAAACTGG - Intronic
1117719446 14:58614819-58614841 TGCCACAGCCTGGGAGATACTGG - Intergenic
1118106179 14:62662470-62662492 TGAGACAGCATGGGTTAACCTGG + Intergenic
1120749758 14:88186662-88186684 TGGGACAGCCTCAGGCAAACTGG - Intronic
1120889083 14:89475851-89475873 TGGATCAGTCTTGGATAAACTGG - Intronic
1121597294 14:95174184-95174206 GTGGTCAGCCTGGGATAAATGGG + Intergenic
1122684205 14:103491931-103491953 TGGGACAGGCTGGGAGAGGCAGG - Exonic
1124422495 15:29535043-29535065 TGAGACAGCCTGGGCAACACAGG + Intronic
1128363707 15:66981991-66982013 TGTGGCTGCCTGGGAGAAACAGG + Intergenic
1128639993 15:69328937-69328959 TGGGGCAGCCAGGCAGAAACAGG + Intronic
1130103525 15:80912100-80912122 TGGGAGAGGCTGGGAGAGACTGG + Intronic
1130103527 15:80912110-80912132 TGGGAGAGACTGGGAAAGACTGG + Intronic
1130934654 15:88458737-88458759 TCAGACGGCCTGGGTTAAACAGG - Intergenic
1131131152 15:89901312-89901334 TAGGACAGCCTGAGAGTAACTGG - Exonic
1131952270 15:97693570-97693592 TGGGAAAACCTGGGGTAAATAGG + Intergenic
1132078297 15:98841564-98841586 TGGGGCAGGCAAGGATAAACAGG - Intronic
1132333238 15:101026823-101026845 TGGGTCAGCCTGGGACACATTGG + Intronic
1132648404 16:1009671-1009693 TGGGGCTGCCTGGGATTGACAGG - Intergenic
1134749826 16:16617211-16617233 TGGGGCAGCCCTGGACAAACTGG + Intergenic
1134995647 16:18736404-18736426 TGGGGCAGCCCTGGACAAACTGG - Intergenic
1137463284 16:48685565-48685587 AGGGACAGCAAGGGATAAAAGGG + Intergenic
1137573288 16:49580386-49580408 TGGGAAAGCCAGGAATAAACAGG - Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1140224966 16:73069689-73069711 TGGGACAGTCTTAGGTAAACTGG - Intergenic
1141648506 16:85379914-85379936 TGGGGCAGCCTGGCATGGACAGG - Intergenic
1144031259 17:11325312-11325334 TAGGACTGCATCGGATAAACTGG + Intronic
1146783807 17:35700689-35700711 TGGGACAGCTGGAGATGAACAGG - Intronic
1147647279 17:42041191-42041213 TGGGACAGCCAGGGAAAGAAAGG + Intronic
1148980880 17:51573917-51573939 TAGGGCTGCCTGGGATCAACAGG - Intergenic
1149546381 17:57506799-57506821 GGGGACAGCCAGGGTTAGACAGG + Intronic
1153727872 18:7976297-7976319 TGGGAGAGGCAGGGATAAATAGG + Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1154442048 18:14398991-14399013 TGGCACAGAATGGGATAAAAAGG + Intergenic
1155063962 18:22253206-22253228 TGGGGCTGCCTGGGATGAAGGGG - Intergenic
1155538842 18:26845561-26845583 TTGGAGAGACTGGGACAAACTGG - Intergenic
1155988004 18:32251233-32251255 TGGGACAGCCTTGGGAGAACAGG + Intronic
1156356802 18:36349071-36349093 TGAGACAGCCCAGGAGAAACTGG - Intronic
1156491570 18:37499479-37499501 GGGGACAGCCTGGGAGGGACGGG + Intronic
1156762845 18:40614141-40614163 TGAGACAGCCTGGGAAATTCAGG - Intergenic
1159448972 18:68575943-68575965 TGTGACAGACTGAGATAAAATGG + Intergenic
1163813489 19:19449147-19449169 AGGGCCAGCCTGGGACAGACAGG - Intronic
1164385701 19:27769208-27769230 TGATACAGCCTGTGATCAACTGG + Intergenic
1165351402 19:35277806-35277828 TGGGACAGCCTGGCTTTAGCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925682497 2:6437415-6437437 TGGGACTGCATGGGGTATACAGG + Intergenic
925921167 2:8638971-8638993 TGGGCTAGCCTGGGATCTACAGG - Intergenic
926043628 2:9693777-9693799 TAGGAAAGCCTGCGAGAAACTGG - Intergenic
926683974 2:15684541-15684563 TGGTACAGCCTGGAGGAAACTGG + Intergenic
927127266 2:20023132-20023154 TAGGACAACCTGGGATGAAGGGG - Intergenic
928220583 2:29399758-29399780 TGGAGGAGCCTGGGACAAACCGG + Intronic
930624762 2:53684608-53684630 TGGGACTACCGAGGATAAACTGG - Intronic
931166458 2:59754495-59754517 GGGGACAGCCTAGGACAAATAGG + Intergenic
933391528 2:81674942-81674964 AGGGACAGCATGGCAAAAACAGG + Intergenic
933731115 2:85456882-85456904 TGGGTGAGCCTGGGATAAGCGGG + Intergenic
935788444 2:106570001-106570023 CAGGACAGCCTGGGTCAAACTGG + Intergenic
937139310 2:119585787-119585809 TGCGACACTCTGGGATACACTGG + Intronic
938784310 2:134611181-134611203 TGGGACAGCCTGGATTCTACTGG - Intronic
939419211 2:141944091-141944113 TGAGACAGCCAAGTATAAACGGG - Intronic
941542613 2:166805525-166805547 CCTGACAACCTGGGATAAACTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942123323 2:172800269-172800291 GAGTACAGCCTGAGATAAACAGG + Intronic
942599771 2:177628951-177628973 TGGGACAGTCTGGCACAAAAAGG + Exonic
944311060 2:198234685-198234707 TTGGAGAGCCAGGGATGAACAGG + Intronic
945027763 2:205635300-205635322 TTGGAGAGCCAGGGATAAGCAGG + Intergenic
946737981 2:222773585-222773607 TGGCACAGACTTGGAAAAACTGG + Intergenic
1170356655 20:15499216-15499238 TGAGACAGCATGAGATAATCAGG - Intronic
1171320827 20:24242602-24242624 TGGGACAGCCTGGGTTGGAAGGG - Intergenic
1171960208 20:31488150-31488172 TGGAACAGGCTGGTATAAAAAGG + Intergenic
1172697255 20:36831369-36831391 TGGGAAACCCTGGGCTATACTGG - Intronic
1173082065 20:39877756-39877778 TGGGACAGCCTGGCCTTAGCTGG - Intergenic
1176035456 20:63034113-63034135 TGGGACAGCCTGGCTCACACAGG + Intergenic
1176058192 20:63160133-63160155 ATGGACAGCCTGGGCTGAACAGG - Intergenic
1176454022 21:6892180-6892202 TGGCACAGAATGGGATAAAAAGG - Intergenic
1176832197 21:13757228-13757250 TGGCACAGAATGGGATAAAAAGG - Intergenic
1178176435 21:30105284-30105306 AGGGAAAGGCTGGGAAAAACAGG + Intergenic
1181460946 22:23085686-23085708 TGGGACAAGCTGGGACAACCAGG - Intronic
1185072901 22:48667029-48667051 AGGGACAGCCTGGGATTGAGGGG + Intronic
1185334275 22:50264604-50264626 TGGGTCGGCCTGGGACAGACAGG + Exonic
949682250 3:6527656-6527678 GGGGACAGCCTGGAATACTCTGG + Intergenic
953420071 3:42747439-42747461 TGGCACAGACTTGGATAAATGGG - Intronic
953975879 3:47381314-47381336 TGGGACAGGCTGAGGAAAACCGG - Intronic
954249485 3:49357223-49357245 TGGCAGAGACTGGGATCAACAGG + Exonic
954376518 3:50196727-50196749 TGGGACAGTCTTGGATCAAGAGG + Intergenic
954424860 3:50437991-50438013 TGGGGCACCCTGGGATCAGCTGG - Intronic
958259265 3:91360797-91360819 TGGGAAAGTCTTAGATAAACTGG + Intergenic
959820977 3:110734829-110734851 TAAGATAGCCTGGGATAAAAAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962705353 3:138038193-138038215 TGGGACAGTCCTGGACAAACTGG - Intergenic
962731869 3:138291002-138291024 TGGGCCAGCCTGGCACAAAACGG - Intronic
963246236 3:143066130-143066152 TGGGAAATCCTGGGCTAAATTGG + Intergenic
968251206 3:197216449-197216471 TGGGGCAGTCTGGGGGAAACTGG + Intronic
968491162 4:891387-891409 TGGAACATCCTGGGACAGACAGG - Intronic
969016440 4:4107056-4107078 TGGGACGGCGTGGGAGAATCAGG + Intergenic
969481170 4:7447801-7447823 TGGGACATCCTGGGATGCACAGG - Intronic
972547768 4:40096841-40096863 TGGGAAAGACTGGGAAAAGCAGG + Intronic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
976604862 4:86973187-86973209 CAGCACAGCCTGGGATCAACAGG - Intronic
977921183 4:102644465-102644487 TGTGACAACCTGGAAGAAACTGG + Intronic
978061565 4:104345609-104345631 TGGGCCAGCCTGGGAGCCACAGG + Intergenic
980069010 4:128222982-128223004 TGCTCCAGCCTGGGAGAAACAGG - Intergenic
983784032 4:171709828-171709850 TGGGGAAGGGTGGGATAAACAGG + Intergenic
983881425 4:172937466-172937488 AGTGACAGCCTGGGATAGCCTGG + Intronic
984842819 4:184083577-184083599 TGGGACAGCCTGGGTGAACTTGG + Intergenic
984856140 4:184197861-184197883 TGGGCCAGACTGGGAGTAACTGG + Intronic
987355214 5:17057768-17057790 TGGGGCAGTATGGGACAAACGGG + Intergenic
988973420 5:36492163-36492185 TGTGACAGACTGGGATTAGCAGG - Intergenic
992075882 5:73192246-73192268 TAGAACAGCATGGGAGAAACTGG - Intergenic
994913161 5:105939244-105939266 TGAGACAGCCTAGTATAAAGGGG - Intergenic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996522650 5:124444433-124444455 TCTGGCAGCCTGGGATAAAGTGG - Intergenic
996638733 5:125728017-125728039 TTGGGGAGCCTGGGACAAACAGG - Intergenic
999780451 5:154845538-154845560 TGAGTCAGCCTGGGAAACACAGG + Intronic
1000322482 5:160145821-160145843 TTGGACTGCCTGGGATTTACTGG - Intergenic
1006785818 6:36666433-36666455 TGGAACAGTCTGGGGCAAACTGG + Intergenic
1006917343 6:37603084-37603106 TGGGCCAGCCTAGGATGACCCGG + Intergenic
1008995989 6:57659795-57659817 TGGGAAAGTCTTAGATAAACTGG - Intergenic
1010859124 6:80883639-80883661 TGGGAAAGTCTGGGTTAAACTGG + Intergenic
1011809033 6:91108571-91108593 TGGGACAGCATGGGAAATGCTGG + Intergenic
1013414218 6:109910218-109910240 GGGGACAGCCTGAGAAGAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015889725 6:137958044-137958066 TGTGAAAGCCTGGAATGAACTGG - Intergenic
1017076897 6:150626980-150627002 TGGGACATGCTGGGAAAAAGGGG + Intronic
1017408089 6:154141254-154141276 TGGTAAAGACTGGGATAAGCGGG - Intronic
1017501117 6:155023961-155023983 TGGTACAGCCTCTGATCAACAGG - Intronic
1023371784 7:39519069-39519091 TGGGTCAGACTGGGTTAGACTGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030619434 7:111772929-111772951 TGGGAAAGCCTGGGAAAAGAAGG + Intronic
1030687847 7:112504962-112504984 AGGGGCAGCCAGGGTTAAACAGG + Intergenic
1032074333 7:128829484-128829506 TGGGTCAGCCAGGCAGAAACAGG - Intergenic
1032117697 7:129130477-129130499 TGGGGCAGTCTGGGATAAACTGG - Intergenic
1033247082 7:139726732-139726754 TGGGCCTGCATGGGATTAACTGG + Intronic
1034680013 7:152921533-152921555 TGGTAGAGACTGGGGTAAACTGG - Intergenic
1035764479 8:2094999-2095021 TGGGACACCCTTGGATTCACAGG + Intronic
1036023766 8:4879641-4879663 TAGGAAAGTCTGAGATAAACTGG + Intronic
1036628072 8:10488597-10488619 TGAGACAGCCTGGGGGAGACAGG + Intergenic
1037898138 8:22671938-22671960 TGGGAAAGGCTGGGAGAGACAGG - Intergenic
1038012912 8:23488815-23488837 TGTGTCAGCCTGGAAGAAACAGG - Intergenic
1042185567 8:66133208-66133230 GGGGAAAGCCTGGGATCACCTGG - Intronic
1043782295 8:84350957-84350979 TGGGACTGCCTTGGATAAGGAGG + Intronic
1045859576 8:106800681-106800703 GGGGGCAGCATGGGATAAACAGG + Intergenic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1047925678 8:129680260-129680282 GGGCATAGTCTGGGATAAACAGG - Intergenic
1048072915 8:131040435-131040457 CGGGGCAGCCTAGGATAAAAAGG - Exonic
1048823466 8:138400459-138400481 AGGGTGAGACTGGGATAAACTGG - Intronic
1049274072 8:141711054-141711076 TGGGAGAGCCTGGGAGGACCTGG + Intergenic
1049921287 9:366814-366836 TGGGACAGGCTGGGAAATGCAGG + Intronic
1057082066 9:92180577-92180599 TGGGCCAGTCTGGGAGAGACGGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058487621 9:105458109-105458131 TGGGCCAGCCTGGGAGCCACGGG - Intronic
1059380525 9:113919977-113919999 TGGTCCAGCCTGGGCTACACAGG + Intronic
1059951074 9:119462968-119462990 TGGGACAGCCTGAGATCAGGAGG - Intergenic
1062055674 9:134468651-134468673 TGGGGCAGCCTGTGATGAGCAGG + Intergenic
1062375255 9:136259142-136259164 GGGGACAGGCAGGGACAAACAGG + Intergenic
1186162588 X:6793276-6793298 TGGGACAGGATGGGAGAAAAGGG + Intergenic
1186615074 X:11177653-11177675 TGGGAGCTCCAGGGATAAACTGG + Intronic
1189440525 X:41031775-41031797 TGGGACAGCCTGGGAAGGGCTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194160354 X:90441723-90441745 TGTGACACCCTGGGAGAACCAGG - Intergenic
1195457646 X:105087121-105087143 TGGGAAATCATGTGATAAACTGG + Intronic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1200506645 Y:4018671-4018693 TGTGACACCCTGGGAGAACCAGG - Intergenic