ID: 903263588

View in Genome Browser
Species Human (GRCh38)
Location 1:22143550-22143572
Sequence TGGGTCCGCCGCGGTCGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903263588_903263599 24 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263599 1:22143597-22143619 GCACCCAGGCGCTGGCGCTCCGG 0: 1
1: 0
2: 1
3: 16
4: 186
903263588_903263600 25 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263588_903263596 10 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263588_903263598 16 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903263588 Original CRISPR TGGGTCCGCCGCGGTCGGAC CGG (reversed) Intronic