ID: 903263596

View in Genome Browser
Species Human (GRCh38)
Location 1:22143583-22143605
Sequence GCTACCACTCGCGCGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903263586_903263596 12 Left 903263586 1:22143548-22143570 CCCCGGTCCGACCGCGGCGGACC 0: 1
1: 0
2: 1
3: 0
4: 35
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263587_903263596 11 Left 903263587 1:22143549-22143571 CCCGGTCCGACCGCGGCGGACCC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263591_903263596 1 Left 903263591 1:22143559-22143581 CCGCGGCGGACCCACCGGAGCGC 0: 1
1: 0
2: 1
3: 5
4: 46
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263582_903263596 18 Left 903263582 1:22143542-22143564 CCCAGACCCCGGTCCGACCGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263581_903263596 25 Left 903263581 1:22143535-22143557 CCTGGAGCCCAGACCCCGGTCCG 0: 1
1: 0
2: 0
3: 32
4: 316
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263588_903263596 10 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263584_903263596 17 Left 903263584 1:22143543-22143565 CCAGACCCCGGTCCGACCGCGGC 0: 1
1: 0
2: 1
3: 12
4: 112
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263590_903263596 5 Left 903263590 1:22143555-22143577 CCGACCGCGGCGGACCCACCGGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263594_903263596 -10 Left 903263594 1:22143570-22143592 CCACCGGAGCGCGGCTACCACTC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31
903263593_903263596 -9 Left 903263593 1:22143569-22143591 CCCACCGGAGCGCGGCTACCACT 0: 1
1: 0
2: 0
3: 3
4: 12
Right 903263596 1:22143583-22143605 GCTACCACTCGCGCGCACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903263596 Original CRISPR GCTACCACTCGCGCGCACCC AGG Intronic