ID: 903263598

View in Genome Browser
Species Human (GRCh38)
Location 1:22143589-22143611
Sequence ACTCGCGCGCACCCAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903263594_903263598 -4 Left 903263594 1:22143570-22143592 CCACCGGAGCGCGGCTACCACTC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263587_903263598 17 Left 903263587 1:22143549-22143571 CCCGGTCCGACCGCGGCGGACCC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263591_903263598 7 Left 903263591 1:22143559-22143581 CCGCGGCGGACCCACCGGAGCGC 0: 1
1: 0
2: 1
3: 5
4: 46
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263593_903263598 -3 Left 903263593 1:22143569-22143591 CCCACCGGAGCGCGGCTACCACT 0: 1
1: 0
2: 0
3: 3
4: 12
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263584_903263598 23 Left 903263584 1:22143543-22143565 CCAGACCCCGGTCCGACCGCGGC 0: 1
1: 0
2: 1
3: 12
4: 112
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263588_903263598 16 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263590_903263598 11 Left 903263590 1:22143555-22143577 CCGACCGCGGCGGACCCACCGGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263582_903263598 24 Left 903263582 1:22143542-22143564 CCCAGACCCCGGTCCGACCGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263586_903263598 18 Left 903263586 1:22143548-22143570 CCCCGGTCCGACCGCGGCGGACC 0: 1
1: 0
2: 1
3: 0
4: 35
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61
903263595_903263598 -7 Left 903263595 1:22143573-22143595 CCGGAGCGCGGCTACCACTCGCG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 903263598 1:22143589-22143611 ACTCGCGCGCACCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903263598 Original CRISPR ACTCGCGCGCACCCAGGCGC TGG Intronic