ID: 903263600

View in Genome Browser
Species Human (GRCh38)
Location 1:22143598-22143620
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903263586_903263600 27 Left 903263586 1:22143548-22143570 CCCCGGTCCGACCGCGGCGGACC 0: 1
1: 0
2: 1
3: 0
4: 35
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263595_903263600 2 Left 903263595 1:22143573-22143595 CCGGAGCGCGGCTACCACTCGCG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263591_903263600 16 Left 903263591 1:22143559-22143581 CCGCGGCGGACCCACCGGAGCGC 0: 1
1: 0
2: 1
3: 5
4: 46
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263587_903263600 26 Left 903263587 1:22143549-22143571 CCCGGTCCGACCGCGGCGGACCC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263588_903263600 25 Left 903263588 1:22143550-22143572 CCGGTCCGACCGCGGCGGACCCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263593_903263600 6 Left 903263593 1:22143569-22143591 CCCACCGGAGCGCGGCTACCACT 0: 1
1: 0
2: 0
3: 3
4: 12
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263594_903263600 5 Left 903263594 1:22143570-22143592 CCACCGGAGCGCGGCTACCACTC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207
903263590_903263600 20 Left 903263590 1:22143555-22143577 CCGACCGCGGCGGACCCACCGGA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 903263600 1:22143598-22143620 CACCCAGGCGCTGGCGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type