ID: 903265075

View in Genome Browser
Species Human (GRCh38)
Location 1:22153358-22153380
Sequence CTCTCTCTTGGGCTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903265070_903265075 -5 Left 903265070 1:22153340-22153362 CCTAGGTGTGACTTAGAACTCTC No data
Right 903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG No data
903265068_903265075 -1 Left 903265068 1:22153336-22153358 CCACCCTAGGTGTGACTTAGAAC No data
Right 903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG No data
903265069_903265075 -4 Left 903265069 1:22153339-22153361 CCCTAGGTGTGACTTAGAACTCT No data
Right 903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903265075 Original CRISPR CTCTCTCTTGGGCTGGTGGA AGG Intergenic
No off target data available for this crispr