ID: 903268294

View in Genome Browser
Species Human (GRCh38)
Location 1:22172012-22172034
Sequence TCACCTACCTTGTAGATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268294_903268299 12 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268299 1:22172047-22172069 CTCTGCAGGTGAGGAAACCGGGG No data
903268294_903268297 10 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268297 1:22172045-22172067 TACTCTGCAGGTGAGGAAACCGG No data
903268294_903268296 3 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268296 1:22172038-22172060 TTCTCTCTACTCTGCAGGTGAGG No data
903268294_903268300 17 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268300 1:22172052-22172074 CAGGTGAGGAAACCGGGGCGTGG No data
903268294_903268301 22 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268301 1:22172057-22172079 GAGGAAACCGGGGCGTGGAGAGG No data
903268294_903268295 -2 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268295 1:22172033-22172055 GACTATTCTCTCTACTCTGCAGG No data
903268294_903268298 11 Left 903268294 1:22172012-22172034 CCATGAATCTACAAGGTAGGTGA No data
Right 903268298 1:22172046-22172068 ACTCTGCAGGTGAGGAAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268294 Original CRISPR TCACCTACCTTGTAGATTCA TGG (reversed) Intergenic