ID: 903268749

View in Genome Browser
Species Human (GRCh38)
Location 1:22174632-22174654
Sequence AACAATGAGCAGGTTGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268749_903268758 20 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data
903268749_903268757 19 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data
903268749_903268753 -2 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268753 1:22174653-22174675 TTTGGTTGCGTCAGAGCCCATGG No data
903268749_903268760 29 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data
903268749_903268759 21 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268759 1:22174676-22174698 GACATGATGAGATGCTACTGGGG No data
903268749_903268754 -1 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268749 Original CRISPR AACAATGAGCAGGTTGGCTT AGG (reversed) Intergenic