ID: 903268751

View in Genome Browser
Species Human (GRCh38)
Location 1:22174638-22174660
Sequence CAACCAAACAATGAGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268751_903268754 -7 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data
903268751_903268759 15 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268759 1:22174676-22174698 GACATGATGAGATGCTACTGGGG No data
903268751_903268758 14 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data
903268751_903268753 -8 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268753 1:22174653-22174675 TTTGGTTGCGTCAGAGCCCATGG No data
903268751_903268757 13 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data
903268751_903268760 23 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268751 Original CRISPR CAACCAAACAATGAGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr