ID: 903268752

View in Genome Browser
Species Human (GRCh38)
Location 1:22174642-22174664
Sequence GACGCAACCAAACAATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268752_903268759 11 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268759 1:22174676-22174698 GACATGATGAGATGCTACTGGGG No data
903268752_903268760 19 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data
903268752_903268758 10 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data
903268752_903268757 9 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268752 Original CRISPR GACGCAACCAAACAATGAGC AGG (reversed) Intergenic
No off target data available for this crispr