ID: 903268754

View in Genome Browser
Species Human (GRCh38)
Location 1:22174654-22174676
Sequence TTGGTTGCGTCAGAGCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268747_903268754 26 Left 903268747 1:22174605-22174627 CCTCTTAGAGGTGGATCATGTGA No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data
903268745_903268754 30 Left 903268745 1:22174601-22174623 CCTCCCTCTTAGAGGTGGATCAT No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data
903268749_903268754 -1 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data
903268746_903268754 27 Left 903268746 1:22174604-22174626 CCCTCTTAGAGGTGGATCATGTG No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data
903268748_903268754 3 Left 903268748 1:22174628-22174650 CCTGCCTAAGCCAACCTGCTCAT No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data
903268751_903268754 -7 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268754 1:22174654-22174676 TTGGTTGCGTCAGAGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268754 Original CRISPR TTGGTTGCGTCAGAGCCCAT GGG Intergenic