ID: 903268757

View in Genome Browser
Species Human (GRCh38)
Location 1:22174674-22174696
Sequence GGGACATGATGAGATGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268749_903268757 19 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data
903268752_903268757 9 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data
903268748_903268757 23 Left 903268748 1:22174628-22174650 CCTGCCTAAGCCAACCTGCTCAT No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data
903268751_903268757 13 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268757 Original CRISPR GGGACATGATGAGATGCTAC TGG Intergenic
No off target data available for this crispr