ID: 903268758 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:22174675-22174697 |
Sequence | GGACATGATGAGATGCTACT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903268748_903268758 | 24 | Left | 903268748 | 1:22174628-22174650 | CCTGCCTAAGCCAACCTGCTCAT | No data | ||
Right | 903268758 | 1:22174675-22174697 | GGACATGATGAGATGCTACTGGG | No data | ||||
903268751_903268758 | 14 | Left | 903268751 | 1:22174638-22174660 | CCAACCTGCTCATTGTTTGGTTG | No data | ||
Right | 903268758 | 1:22174675-22174697 | GGACATGATGAGATGCTACTGGG | No data | ||||
903268749_903268758 | 20 | Left | 903268749 | 1:22174632-22174654 | CCTAAGCCAACCTGCTCATTGTT | No data | ||
Right | 903268758 | 1:22174675-22174697 | GGACATGATGAGATGCTACTGGG | No data | ||||
903268752_903268758 | 10 | Left | 903268752 | 1:22174642-22174664 | CCTGCTCATTGTTTGGTTGCGTC | No data | ||
Right | 903268758 | 1:22174675-22174697 | GGACATGATGAGATGCTACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903268758 | Original CRISPR | GGACATGATGAGATGCTACT GGG | Intergenic | ||