ID: 903268758

View in Genome Browser
Species Human (GRCh38)
Location 1:22174675-22174697
Sequence GGACATGATGAGATGCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268748_903268758 24 Left 903268748 1:22174628-22174650 CCTGCCTAAGCCAACCTGCTCAT No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data
903268752_903268758 10 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data
903268751_903268758 14 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data
903268749_903268758 20 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268758 1:22174675-22174697 GGACATGATGAGATGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903268758 Original CRISPR GGACATGATGAGATGCTACT GGG Intergenic