ID: 903268760

View in Genome Browser
Species Human (GRCh38)
Location 1:22174684-22174706
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903268752_903268760 19 Left 903268752 1:22174642-22174664 CCTGCTCATTGTTTGGTTGCGTC No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data
903268751_903268760 23 Left 903268751 1:22174638-22174660 CCAACCTGCTCATTGTTTGGTTG No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data
903268756_903268760 -9 Left 903268756 1:22174670-22174692 CCATGGGACATGATGAGATGCTA No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data
903268749_903268760 29 Left 903268749 1:22174632-22174654 CCTAAGCCAACCTGCTCATTGTT No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data
903268755_903268760 -8 Left 903268755 1:22174669-22174691 CCCATGGGACATGATGAGATGCT No data
Right 903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr