ID: 903270895

View in Genome Browser
Species Human (GRCh38)
Location 1:22187631-22187653
Sequence CCGTGGAAGGATGCGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903270895_903270906 9 Left 903270895 1:22187631-22187653 CCCCATCCCGCATCCTTCCACGG No data
Right 903270906 1:22187663-22187685 CCTCTGTGAGCAGAACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903270895 Original CRISPR CCGTGGAAGGATGCGGGATG GGG (reversed) Intergenic
No off target data available for this crispr