ID: 903274674

View in Genome Browser
Species Human (GRCh38)
Location 1:22212921-22212943
Sequence CACGCTAATCCTCTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903274658_903274674 17 Left 903274658 1:22212881-22212903 CCTCTCTCCGGGGAGGATGTGCC No data
Right 903274674 1:22212921-22212943 CACGCTAATCCTCTGGGGAGGGG No data
903274661_903274674 10 Left 903274661 1:22212888-22212910 CCGGGGAGGATGTGCCGCTGGGG No data
Right 903274674 1:22212921-22212943 CACGCTAATCCTCTGGGGAGGGG No data
903274657_903274674 18 Left 903274657 1:22212880-22212902 CCCTCTCTCCGGGGAGGATGTGC No data
Right 903274674 1:22212921-22212943 CACGCTAATCCTCTGGGGAGGGG No data
903274664_903274674 -4 Left 903274664 1:22212902-22212924 CCGCTGGGGGCCTCCCAGCCACG No data
Right 903274674 1:22212921-22212943 CACGCTAATCCTCTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903274674 Original CRISPR CACGCTAATCCTCTGGGGAG GGG Intergenic
No off target data available for this crispr