ID: 903275235

View in Genome Browser
Species Human (GRCh38)
Location 1:22217408-22217430
Sequence GGCCCCACTCCCTATTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275235_903275236 -7 Left 903275235 1:22217408-22217430 CCTAGCTAATAGGGAGTGGGGCC No data
Right 903275236 1:22217424-22217446 TGGGGCCTGAACTTGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275235 Original CRISPR GGCCCCACTCCCTATTAGCT AGG (reversed) Intergenic
No off target data available for this crispr