ID: 903275608

View in Genome Browser
Species Human (GRCh38)
Location 1:22219414-22219436
Sequence GAGGCAGCCTGGCTAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275608_903275617 27 Left 903275608 1:22219414-22219436 CCCCTCTCTAGCCAGGCTGCCTC No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275608_903275612 -6 Left 903275608 1:22219414-22219436 CCCCTCTCTAGCCAGGCTGCCTC No data
Right 903275612 1:22219431-22219453 TGCCTCTCACTCTCTGATCCAGG No data
903275608_903275616 26 Left 903275608 1:22219414-22219436 CCCCTCTCTAGCCAGGCTGCCTC No data
Right 903275616 1:22219463-22219485 GGCCTTTCCTCTTCTGCCTCTGG No data
903275608_903275614 5 Left 903275608 1:22219414-22219436 CCCCTCTCTAGCCAGGCTGCCTC No data
Right 903275614 1:22219442-22219464 CTCTGATCCAGGCAAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275608 Original CRISPR GAGGCAGCCTGGCTAGAGAG GGG (reversed) Intergenic