ID: 903275609

View in Genome Browser
Species Human (GRCh38)
Location 1:22219415-22219437
Sequence AGAGGCAGCCTGGCTAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275609_903275614 4 Left 903275609 1:22219415-22219437 CCCTCTCTAGCCAGGCTGCCTCT No data
Right 903275614 1:22219442-22219464 CTCTGATCCAGGCAAGCAAGTGG No data
903275609_903275616 25 Left 903275609 1:22219415-22219437 CCCTCTCTAGCCAGGCTGCCTCT No data
Right 903275616 1:22219463-22219485 GGCCTTTCCTCTTCTGCCTCTGG No data
903275609_903275612 -7 Left 903275609 1:22219415-22219437 CCCTCTCTAGCCAGGCTGCCTCT No data
Right 903275612 1:22219431-22219453 TGCCTCTCACTCTCTGATCCAGG No data
903275609_903275617 26 Left 903275609 1:22219415-22219437 CCCTCTCTAGCCAGGCTGCCTCT No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275609 Original CRISPR AGAGGCAGCCTGGCTAGAGA GGG (reversed) Intergenic