ID: 903275610

View in Genome Browser
Species Human (GRCh38)
Location 1:22219416-22219438
Sequence GAGAGGCAGCCTGGCTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275610_903275617 25 Left 903275610 1:22219416-22219438 CCTCTCTAGCCAGGCTGCCTCTC No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275610_903275614 3 Left 903275610 1:22219416-22219438 CCTCTCTAGCCAGGCTGCCTCTC No data
Right 903275614 1:22219442-22219464 CTCTGATCCAGGCAAGCAAGTGG No data
903275610_903275612 -8 Left 903275610 1:22219416-22219438 CCTCTCTAGCCAGGCTGCCTCTC No data
Right 903275612 1:22219431-22219453 TGCCTCTCACTCTCTGATCCAGG No data
903275610_903275616 24 Left 903275610 1:22219416-22219438 CCTCTCTAGCCAGGCTGCCTCTC No data
Right 903275616 1:22219463-22219485 GGCCTTTCCTCTTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275610 Original CRISPR GAGAGGCAGCCTGGCTAGAG AGG (reversed) Intergenic