ID: 903275611

View in Genome Browser
Species Human (GRCh38)
Location 1:22219425-22219447
Sequence TCAGAGAGTGAGAGGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275611_903275617 16 Left 903275611 1:22219425-22219447 CCAGGCTGCCTCTCACTCTCTGA No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275611_903275614 -6 Left 903275611 1:22219425-22219447 CCAGGCTGCCTCTCACTCTCTGA No data
Right 903275614 1:22219442-22219464 CTCTGATCCAGGCAAGCAAGTGG No data
903275611_903275616 15 Left 903275611 1:22219425-22219447 CCAGGCTGCCTCTCACTCTCTGA No data
Right 903275616 1:22219463-22219485 GGCCTTTCCTCTTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275611 Original CRISPR TCAGAGAGTGAGAGGCAGCC TGG (reversed) Intergenic