ID: 903275613 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:22219433-22219455 |
Sequence | TGCCTGGATCAGAGAGTGAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903275613_903275617 | 8 | Left | 903275613 | 1:22219433-22219455 | CCTCTCACTCTCTGATCCAGGCA | No data | ||
Right | 903275617 | 1:22219464-22219486 | GCCTTTCCTCTTCTGCCTCTGGG | No data | ||||
903275613_903275616 | 7 | Left | 903275613 | 1:22219433-22219455 | CCTCTCACTCTCTGATCCAGGCA | No data | ||
Right | 903275616 | 1:22219463-22219485 | GGCCTTTCCTCTTCTGCCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903275613 | Original CRISPR | TGCCTGGATCAGAGAGTGAG AGG (reversed) | Intergenic | ||