ID: 903275613

View in Genome Browser
Species Human (GRCh38)
Location 1:22219433-22219455
Sequence TGCCTGGATCAGAGAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275613_903275617 8 Left 903275613 1:22219433-22219455 CCTCTCACTCTCTGATCCAGGCA No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275613_903275616 7 Left 903275613 1:22219433-22219455 CCTCTCACTCTCTGATCCAGGCA No data
Right 903275616 1:22219463-22219485 GGCCTTTCCTCTTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275613 Original CRISPR TGCCTGGATCAGAGAGTGAG AGG (reversed) Intergenic