ID: 903275615

View in Genome Browser
Species Human (GRCh38)
Location 1:22219449-22219471
Sequence GGAAAGGCCACTTGCTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275615_903275617 -8 Left 903275615 1:22219449-22219471 CCAGGCAAGCAAGTGGCCTTTCC No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275615_903275623 18 Left 903275615 1:22219449-22219471 CCAGGCAAGCAAGTGGCCTTTCC No data
Right 903275623 1:22219490-22219512 TTGCACATACTGTTCCAGCTGGG No data
903275615_903275622 17 Left 903275615 1:22219449-22219471 CCAGGCAAGCAAGTGGCCTTTCC No data
Right 903275622 1:22219489-22219511 TTTGCACATACTGTTCCAGCTGG No data
903275615_903275616 -9 Left 903275615 1:22219449-22219471 CCAGGCAAGCAAGTGGCCTTTCC No data
Right 903275616 1:22219463-22219485 GGCCTTTCCTCTTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275615 Original CRISPR GGAAAGGCCACTTGCTTGCC TGG (reversed) Intergenic