ID: 903275617

View in Genome Browser
Species Human (GRCh38)
Location 1:22219464-22219486
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275615_903275617 -8 Left 903275615 1:22219449-22219471 CCAGGCAAGCAAGTGGCCTTTCC No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275610_903275617 25 Left 903275610 1:22219416-22219438 CCTCTCTAGCCAGGCTGCCTCTC No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275613_903275617 8 Left 903275613 1:22219433-22219455 CCTCTCACTCTCTGATCCAGGCA No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275611_903275617 16 Left 903275611 1:22219425-22219447 CCAGGCTGCCTCTCACTCTCTGA No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275609_903275617 26 Left 903275609 1:22219415-22219437 CCCTCTCTAGCCAGGCTGCCTCT No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data
903275608_903275617 27 Left 903275608 1:22219414-22219436 CCCCTCTCTAGCCAGGCTGCCTC No data
Right 903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr