ID: 903275959

View in Genome Browser
Species Human (GRCh38)
Location 1:22222136-22222158
Sequence GGCATGCATGAAGGTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903275959_903275962 -6 Left 903275959 1:22222136-22222158 CCTTTCTCACCTTCATGCATGCC No data
Right 903275962 1:22222153-22222175 CATGCCCCACGGCACACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903275959 Original CRISPR GGCATGCATGAAGGTGAGAA AGG (reversed) Intergenic