ID: 903276536

View in Genome Browser
Species Human (GRCh38)
Location 1:22225672-22225694
Sequence GCATACACCCTATTCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903276536_903276544 20 Left 903276536 1:22225672-22225694 CCAGTTTGGAATAGGGTGTATGC No data
Right 903276544 1:22225715-22225737 CAGGAGTCACATCTGGCTGTAGG No data
903276536_903276543 13 Left 903276536 1:22225672-22225694 CCAGTTTGGAATAGGGTGTATGC No data
Right 903276543 1:22225708-22225730 GGCTGCTCAGGAGTCACATCTGG No data
903276536_903276542 1 Left 903276536 1:22225672-22225694 CCAGTTTGGAATAGGGTGTATGC No data
Right 903276542 1:22225696-22225718 GGGTGAAAACTGGGCTGCTCAGG No data
903276536_903276539 -9 Left 903276536 1:22225672-22225694 CCAGTTTGGAATAGGGTGTATGC No data
Right 903276539 1:22225686-22225708 GGTGTATGCCGGGTGAAAACTGG No data
903276536_903276540 -8 Left 903276536 1:22225672-22225694 CCAGTTTGGAATAGGGTGTATGC No data
Right 903276540 1:22225687-22225709 GTGTATGCCGGGTGAAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903276536 Original CRISPR GCATACACCCTATTCCAAAC TGG (reversed) Intergenic
No off target data available for this crispr